Tel : 301-363-4651 Professional and Accurate! We are your good partner in biology research.

Product Name:

NUMB cDNA Clone

Product Type : Clone
Code : CSB-CL016186HU
Size : 10 μg plasmid + 200μl Glycerol
Relevance : Homo sapiens numb homolog (Drosophila) (NUMB), transcript variant 1, mRNA
Alias : C14orf41,c14_5527,S171
Sample Types : pUC
Sequence : ATGAACAAATTACGGCAAAGTTTTAGGAGAAAGAAGGATGTTTATGTTCCAGAGGCCAGTCGTCCACATCAGTGGCAGACAGATGAAGAAGGCGTTCGCACCGGAAAATGTAGCTTCCCGGTTAAGTACCTTGGCCATGTAGAAGTTGATGAATCAAGAGGAATGCACATCTGTGAAGATGCTGTAAAAAGATTGAAAGCTGAAAGGAAGTTCTTCAAAGGCTTCTTTGGAAAAACTGGAAAGAAAGCAGTTAAAGCAGTTCTGTGGGTCTCAGCAGATGGACTCAGAGTTGTGGATGAAAAAACTAAGGACCTCATAGTTGACCAGACGATAGAGAAAGTTTCTTTCTGTGCCCCAGACAGGAACTTTGATAGAGCCTTTTCTTACATATGCCGTGATGGCACCACTCGTCGCTGGATCTGTCACTGCTTCATGGCTGTCAAGGACACAGGTGAAAGGTTGAGCCATGCAGTAGGCTGTGCTTTTGCAGCCTGTTTAGAGCGCAAGCAGAAGCGGGAGAAGGAATGTGGAGTGACTGCTACTTTTGATGCTAGTCGGACCACTTTTACAAGAGAAGGATCATTCCGTGTCACAACAGCCACTGAACAAGCAGAAAGAGAGGAGATCATGAAACAAATGCAAGATGCCAAGAAAGCTGAAACAGATAAGATAGTCGTTGGTTCATCAGTTGCCCCTGGCAACACTGCCCCATCCCCATCCTCTCCCACCTCTCCTACTTCTGATGCCACGACCTCTCTGGAGATGAACAATCCTCATGCCATCCCACGCCGGCATGCTCCAATTGAACAGCTTGCTCGCCAAGGCTCTTTCCGAGGTTTTCCTGCTCTTAGCCAGAAGATGTCACCCTTTAAACGCCAACTATCCCTACGCATCAATGAGTTGCCTTCCACTATGCAGAGGAAGACTGATTTCCCCATTAAAAATGCAGTGCCAGAAGTAGAAGGGGAGGCAGAGAGCATCAGCTCCCTGTGCTCACAGATCACCAATGCCTTCAGCACACCTGAGGACCCCTTCTCATCTGCTCCGATGACCAAACCAGTGACAGTGGTGGCACCACAATCTCCTACCTTCCAAGCTAATGGCACTGACTCAGCCTTCCATGTGCTTGCTAAGCCAGCCCATACTGCTCTAGCACCCGTAGCAATGCCTGTGCGTGAAACCAACCCTTGGGCCCATGCCCCTGATGCTGCTAACAAGGAAATTGCAGCCACATGTTCGGGGACCGAGTGGGGTCAATCTTCTGGTGCTGCCTCTCCAGGTCTCTTCCAGGCCGGTCATAGACGTACTCCCTCTGAGGCCGACCGATGGTTAGAAGAGGTGTCTAAGAGCGTCCGGGCTCAGCAGCCCCAGGCCTCAGCTGCTCCTCTGCAGCCAGTTCTCCAGCCTCCTCCACCCACTGCCATCTCCCAGCCAGCATCACCTTTCCAAGGGAATGCATTCCTCACCTCTCAGCCTGTGCCAGTGGGTGTGGTCCCAGCCCTGCAACCAGCCTTTGTCCCTGCCCAGTCCTATCCTGTGGCCAATGGAATGCCCTATCCAGCCCCTAATGTGCCTGTGGTGGGCATCACTCCCTCCCAGATGGTGGCCAACGTATTTGGCACTGCAGGCCACCCTCAGGCTGCCCATCCCCATCAGTCACCCAGCCTGGTCAGGCAGCAGACATTCCCTCACTACGAGGCAAGCAGTGCTACCACCAGTCCCTTCTTTAAGCCTCCTGCTCAGCACCTCAACGGTTCTGCAGCTTTCAATGGTGTAGATGATGGCAGGTTGGCCTCAGCAGACAGGCATACAGAGGTTCCTACAGGCACCTGCCCAGTGGATCCTTTTGAAGCCCAGTGGGCTGCATTAGAAAATAAGTCCAAGCAGCGTACTAATCCCTCCCCTACCAACCCTTTCTCCAGTGACTTACAGAAGACGTTTGAAATTGAACTTTAA
Protein Names : 8650
Accession NO. : NM_001005743
Contact us
Prev product: c-rel
Next product: CCR8

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2015 www.cusabio.com Cusabio Biotech Co., Ltd All Rights Reserved.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.