CASP8

Code CSB-CL621791HU4
Size 10 μg plasmid + 200μl Glycerol
Uniprot No. Q14790
Relevance Homo sapiens caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B, mRNA.
Alias ALPS2B; CAP4; Casp-8; FLICE; MACH; MCH5
Species Homo sapiens (Human)
Vector pUC
Sequence ATGGACTTCAGCAGAAATCTTTATGATATTGGGGAACAACTGGACAGTGAAGATCTGGCCTCCCTCAAGTTCCTGAGCCTGGACTACATTCCGCAAAGGAAGCAAGAACCCATCAAGGATGCCTTGATGTTATTCCAGAGACTCCAGGAAAAGAGAATGTTGGAGGAAAGCAATCTGTCCTTCCTGAAGGAGCTGCTCTTCCGAATTAATAGACTGGATTTGCTGATTACCTACCTAAACACTAGAAAGGAGGAGATGGAAAGGGAACTTCAGACACCAGGCAGGGCTCAAATTTCTGCCTACAGGGTCATGCTCTATCAGATTTCAGAAGAAGTGAGCAGATCAGAATTGAGGTCTTTTAAGTTTCTTTTGCAAGAGGAAATCTCCAAATGCAAACTGGATGATGACATGAACCTGCTGGATATTTTCATAGAGATGGAGAAGAGGGTCATCCTGGGAGAAGGAAAGTTGGACATCCTGAAAAGAGTCTGTGCCCAAATCAACAAGAGCCTGCTGAAGATAATCAACGACTATGAAGAATTCAGCAAAGAGAGAAGCAGCAGCCTTGAAGGAAGTCCTGATGAATTTTCAAATGGGGAGGAGTTGTGTGGGGTAATGACAATCTCGGACTCTCCAAGAGAACAGGATAGTGAATCACAGACTTTGGACAAAGTTTACCAAATGAAAAGCAAACCTCGGGGATACTGTCTGATCATCAACAATCACAATTTTGCAAAAGCACGGGAGAAAGTGCCCAAACTTCACAGCATTAGGGACAGGAATGGAACACACTTGGATGCAGGGGCTTTGACCACGACCTTTGAAGAGCTTCATTTTGAGATCAAGCCCCACGATGACTGCACAGTAGAGCAAATCTATGAGATTTTGAAAATCTACCAACTCATGGACCACAGTAACATGGACTGCTTCATCTGCTGTATCCTCTCCCATGGAGACAAGGGCATCATCTATGGCACTGATGGACAGGAGGCCCCCATCTATGAGCTGACATCTCAGTTCACTGGTTTGAAGTGCCCTTCCCTTGCTGGAAAACCCAAAGTGTTTTTTATTCAGGCTTGTCAGGGGGATAACTACCAGAAAGGTATACCTGTTGAGACTGATTCAGAGGAGCAACCCTATTTAGAAATGGATTTATCATCACCTCAAACGAGATATATCCCGGATGAGGCTGACTTTCTGCTGGGGATGGCCACTGTGAATAACTGTGTTTCCTACCGAAACCCTGCAGAGGGAACCTGGTACATCCAGTCACTTTGCCAGAGCCTGAGAGAGCGATGTCCTCGAGGCGATGATATTCTCACCATCCTGACTGAAGTGAACTATGAAGTAAGCAACAAGGATGACAAGAAAAACATGGGGAAACAGATGCCTCAGCCTACTTTCACACTAAGAAAAAAACTTGTCTTCCCTTCTGATTGA
Gene Names CASP8
Accession NO. NM_033355.3
Target Details This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain, a large protease subunit, and a small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This protein is involved in the programmed cell death induced by Fas and various apoptotic stimuli. The N-terminal FADD-like death effector domain of this protein suggests that it may interact with Fas-interacting protein FADD. This protein was detected in the insoluble fraction of the affected brain region from Huntington disease patients but not in those from normal controls, which implicated the role in neurodegenerative diseases. Many alternatively spliced transcript variants encoding different isoforms have been described, although not all variants have had their full-length sequences determined.
HGNC 1876
RGD 620847
MGI 1336166
Still Have Questions? Leave a Message or Start an on-line Chat
Function Most upstream protease of the activation cascade of caspases responsible for the TNFRSF6/FAS mediated and TNFRSF1A induced cell death. Binding to the adapter molecule FADD recruits it to either receptor. The resulting aggregate called death-inducing signaling complex (DISC) performs CASP8 proteolytic activation. The active dimeric enzyme is then liberated from the DISC and free to activate downstream apoptotic proteases. Proteolytic fragments of the N-terminal propeptide (termed CAP3, CAP5 and CAP6) are likely retained in the DISC. Cleaves and activates CASP3, CASP4, CASP6, CASP7, CASP9 and CASP10. May participate in the GZMB apoptotic pathways. Cleaves ADPRT. Hydrolyzes the small-molecule substrate, Ac-Asp-Glu-Val-Asp-|-AMC. Likely target for the cowpox virus CRMA death inhibitory protein. Isoform 5, isoform 6, isoform 7 and isoform 8 lack the catalytic site and may interfere with the pro-apoptotic activity of the complex.
Involvement in disease Caspase-8 deficiency (CASP8D)
Subcellular Location Cytoplasm
Protein Families Peptidase C14A family
Tissue Specificity Isoform 1, isoform 5 and isoform 7 are expressed in a wide variety of tissues. Highest expression in peripheral blood leukocytes, spleen, thymus and liver. Barely detectable in brain, testis and skeletal muscle.
Database Links

HGNC: 1509

OMIM: 211980

KEGG: hsa:841

STRING: 9606.ENSP00000351273

UniGene: Hs.599762

Pathway p53 signaling pathway
TNF signaling pathway
Apoptosis
Necroptosis
IL-17 signaling pathway
NOD-like receptor signaling pathway
Toll-like receptor signaling pathway

Related Products

CASP8 Antibodies

CASP8 Antibodies for Homo sapiens (Human)

CASP8 Antibodies for Human

CASP8 Proteins

CASP8 Proteins for Mus musculus (Mouse)

CASP8 Proteins for Homo sapiens (Human)

CASP8 cDNA

CASP8 cDNA for Homo sapiens (Human)

CASP8 ELISA Kit

CASP8 ELISA Kit for Homo sapiens (Human)

CASP8 ELISA Kit for Mus musculus (Mouse)

CASP8 ELISA Kit for Rattus norvegicus (Rat)

Most popular with customers

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2018 www.cusabio.com CUSABIO TECHNOLOGY LLC All Rights Reserved.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.