Tel : 301-363-4651 Professional and Accurate! We are your good partner in biology research.

Product Name:

CCR8

Product Type : Clone
Code : CSB-CL004847HU
Size : 10 μg plasmid + 200μl Glycerol
Relevance : Homo sapiens C-C motif chemokine receptor 8 (CCR8), mRNA
Alias : CC-CKR-8; CCR-8; CDw198; CKRL1; CMKBR8; CMKBRL2; CY6; GPRCY6; TER1
Sample Types : pUC
Sequence : ATGGATTATACACTTGACCTCAGTGTGACAACAGTGACCGACTACTACTACCCTGATATCTTCTCAAGCCCCTGTGATGCGGAACTTATTCAGACAAATGGCAAGTTGCTCCTTGCTGTCTTTTATTGCCTCCTGTTTGTATTCAGTCTTCTGGGAAACAGCCTGGTCATCCTGGTCCTTGTGGTCTGCAAGAAGCTGAGGAGCATCACAGATGTATACCTCTTGAACCTGGCCCTGTCTGACCTGCTTTTTGTCTTCTCCTTCCCCTTTCAGACCTACTATCTGCTGGACCAGTGGGTGTTTGGGACTGTAATGTGCAAAGTGGTGTCTGGCTTTTATTACATTGGCTTCTACAGCAGCATGTTTTTCATCACCCTCATGAGTGTGGACAGGTACCTGGCTGTTGTCCATGCCGTGTATGCCCTAAAGGTGAGGACGATCAGGATGGGCACAACGCTGTGCCTGGCAGTATGGCTAACCGCCATTATGGCTACCATCCCATTGCTAGTGTTTTACCAAGTGGCCTCTGAAGATGGTGTTCTACAGTGTTATTCATTTTACAATCAACAGACTTTGAAGTGGAAGATCTTCACCAACTTCAAAATGAACATTTTAGGCTTGTTGATCCCATTCACCATCTTTATGTTCTGCTACATTAAAATCCTGCACCAGCTGAAGAGGTGTCAAAACCACAACAAGACCAAGGCCATCAGGTTGGTGCTCATTGTGGTCATTGCATCTTTACTTTTCTGGGTCCCATTCAACGTGGTTCTTTTCCTCACTTCCTTGCACAGTATGCACATCTTGGATGGATGTAGCATAAGCCAACAGCTGACTTATGCCACCCATGTCACAGAAATCATTTCCTTTACTCACTGCTGTGTGAACCCTGTTATCTATGCTTTTGTTGGGGAGAAGTTCAAGAAACACCTCTCAGAAATATTTCAGAAAAGTTGCAGCCAAATCTTCAACTACCTAGGAAGACAAATGCCTAGGGAGAGCTGTGAAAAGTCATCATCCTGCCAGCAGCACTCCTCCCGTTCCTCCAGCGTAGACTACATTTTGTGA
Protein Names : 1237
Accession NO. : NM_005201
Contact us
Prev product:  NUMB cDNA Clone
Next product: EHMT2

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2015 www.cusabio.com Cusabio Biotech Co., Ltd All Rights Reserved.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.