Code CSB-CL835458CH
Size 10 μg plasmid + 200μl Glycerol
Uniprot No. Q90694
Relevance Gallus gallus cell division cycle 42 (GTP binding protein, 25kDa) (CDC42), mRNA.
Species Gallus gallus (Chicken)
Vector pUC
Sequence atgcagacgatt aagtgtgtag ttgtgggtga tggtgctgtt ggtaaaacct gtctcttaatttcttacaca acaaataaat ttccatcgga atacgtacca acggtttttg ataactatgctgtaacagtg atgattggag gagagcctta cactctaggc ctctttgata ctgcaggtcaggaagattat gatagattac gacccctcag ctatccacag acagatgtat ttctggtctgtttttcagtg gtatctcctt cttcatttga aaatgtgaaa gaaaagtggg tacctgaaattactcaccat tgtccaaaga ctccttttct gcttgttggg acccaaattg atctaagagatgatccctca acaattgaaa aacttgccaa gaacaagcag aagcccataa ctccagagacggctgaaaaa ctggcccggg acctgaaggc tgttaaatat gtggaatgct ctgcgcttacgcagaaaggc ctaaagaatg tatttgatga ggcgatattg gctgccctgg agcctccggagccgaagaag actcgcaggt gtgtgctgct atga
Gene Names CDC42
Accession NO. NM_205048.1
Target Details This protein is a small GTPase of the Rho-subfamily, which regulates signaling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. This protein is highly similar to Saccharomyces cerevisiae Cdc 42, and is able to complement the yeast cdc42-1 mutant. The product of oncogene Dbl was reported to specifically catalyze the dissociation of GDP from this protein. This protein could regulate actin polymerization through its direct binding to Neural Wiskott-Aldrich syndrome protein (N-WASP), which subsequently activates Arp2/3 complex. Alternative splicing of this gene results in multiple transcript variants.
HGNC 1737
RGD 621406
MGI 2441841
Still Have Questions? Leave a Message or Start an on-line Chat
Function Plasma membrane-associated small GTPase which cycles between an active GTP-bound and an inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses. Involved in epithelial cell polarization processes. Regulates the bipolar attachment of spindle microtubules to kinetochores before chromosome congression in metaphase. Plays a role in the extension and maintenance of the formation of thin, actin-rich surface projections called filopodia. Mediates CDC42-dependent cell migration. Required for DOCK10-mediated spine formation in Purkinje cells and hippocampal neurons. Facilitates filopodia formation upon DOCK11-activation. Also plays a role in phagocytosis through organization of the F-actin cytoskeleton associated with forming phagocytic cups.
Subcellular Location Cell membrane, Lipid-anchor, Cytoplasmic side, Midbody
Protein Families Small GTPase superfamily, Rho family, CDC42 subfamily
Database Links

KEGG: gga:395917

STRING: 9031.ENSGALP00000007641

UniGene: Gga.4438

Pathway Ras signaling pathway
Chemokine signaling pathway
MAPK signaling pathway
VEGF signaling pathway
Focal adhesion
Regulation of actin cytoskeleton
Adherens junction
Fc gamma R-mediated phagocytosis
Leukocyte transendothelial migration
T cell receptor signaling pathway
AGE-RAGE signaling pathway in diabetic complications
Rap1 signaling pathway
Neurotrophin signaling pathway

Related Products

CDC42 Antibodies

CDC42 Antibodies for Homo sapiens (Human)

CDC42 Antibodies for Drosophila melanogaster (Fruit fly)

CDC42 Antibodies for Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) (Yeast) (Eremothecium gossypii)

CDC42 Antibodies for Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast)

CDC42 Antibodies for Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast)

CDC42 Proteins

CDC42 Proteins for Mus musculus (Mouse)

CDC42 Proteins for Homo sapiens (Human)

CDC42 Proteins for Canis lupus familiaris (Dog) (Canis familiaris)

CDC42 Proteins for Candida albicans (strain SC5314 / ATCC MYA-2876) (Yeast)

CDC42 Proteins for Candida albicans (strain WO-1) (Yeast)

CDC42 Proteins for Colletotrichum gloeosporioides (Anthracnose fungus) (Glomerella cingulata)

CDC42 Proteins for Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast)

CDC42 Proteins for Drosophila melanogaster (Fruit fly)

CDC42 Proteins for Anopheles gambiae (African malaria mosquito)

CDC42 Proteins for Aedes aegypti (Yellowfever mosquito) (Culex aegypti)

CDC42 Proteins for Drosophila pseudoobscura pseudoobscura (Fruit fly)

CDC42 Proteins for Bos taurus (Bovine)

CDC42 Proteins for Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey)

CDC42 Proteins for Rattus norvegicus (Rat)

CDC42 Proteins for Gallus gallus (Chicken)

CDC42 Proteins for Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) (Yeast) (Eremothecium gossypii)


CDC42 cDNA for Rattus norvegicus (Rat)

Most popular with customers


Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2018 CUSABIO TECHNOLOGY LLC All Rights Reserved.


Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.


Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.