Code CSB-CL751094DO
Size 10 μg plasmid + 200μl Glycerol
Uniprot No. Q6YKA4
Relevance Canis lupus familiaris high mobility group box 1 (HMGB1), mRNA.
Alias HMG1
Species Canis lupus familiaris (Dog) (Canis familiaris)
Vector pUC
Sequence a tgggcaaagg agatcctaag aagccgagaggcaaaatgtc atcatatgca ttctttgtgc aaacttgccg agaggagcac aagaagaagcacccagatgc ttcagtcaac ttctcagagt tttctaagaa gtgctcagaa aggtggaagaccatgtctgc taaagagaaa ggaaaatttg aagacatggc taaggcggac aaggcccgttatgaaagaga aatgaaaact tatatccccc ctaaagggga aacaaaaaag aagttcaaggatcccaatgc acccaagagg cctccctcgg cctttttctt gttttgttct gagtatcgcccaaaaatcaa aggagagcat cccggcctat ccattggtga tgttgcaaag aaactgggagagatgtggaa taacactgct gcagatgaca agcagcctta tgaaaagaag gctgctaagctgaaggaaaa atatgaaaag gatattgctg cgtaccgagc taaaggaaag cctgatgcggcaaaaaaggg agttgtcaag gctgaaaaga gcaagaaaaa gaaggaagag gaggaagacgaggaggatga agaggatgag gaggaggaag aagatgaaga agatgaagat gaagaagaagatgatgatga tgaataa
Gene Names HMGB1
Accession NO. NM_001002937.1
HGNC 4983
RGD 2802
MGI 96113
Still Have Questions? Leave a Message or Start an on-line Chat
Function Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance. Has proangiogenic activity. May be involved in platelet activation. Binds to phosphatidylserine and phosphatidylethanolamide. Bound to RAGE mediates signaling for neuronal outgrowth. May play a role in accumulation of expanded polyglutamine (polyQ) proteins.
Subcellular Location Nucleus, Chromosome, Cytoplasm, Secreted, Cell membrane, Peripheral membrane protein, Extracellular side, Endosome, Endoplasmic reticulum-Golgi intermediate compartment
Protein Families HMGB family
Database Links

KEGG: cfa:403170

STRING: 9615.ENSCAFP00000009862

UniGene: Cfa.416

Pathway Autophagy
DNA repair pathway

Related Products

HMGB1 Antibodies

HMGB1 Antibodies for Human

HMGB1 Antibodies for Homo sapiens (Human)

HMGB1 Antibodies for

HMGB1 Antibodies for Arabidopsis thaliana (Mouse-ear cress)

HMGB1 Antibodies for Gallus gallus (Chicken)

HMGB1 Proteins

HMGB1 Proteins for Bos taurus (Bovine)

HMGB1 Proteins for Sus scrofa (Pig)

HMGB1 Proteins for Mus musculus (Mouse)

HMGB1 Proteins for Rattus norvegicus (Rat)

HMGB1 Proteins for Homo sapiens (Human)

HMGB1 Proteins for Cricetulus griseus (Chinese hamster) (Cricetulus barabensis griseus)

HMGB1 Proteins for Papio anubis (Olive baboon)

HMGB1 Proteins for Arabidopsis thaliana (Mouse-ear cress)

HMGB1 Proteins for Callithrix jacchus (White-tufted-ear marmoset)

HMGB1 Proteins for Plecturocebus moloch (Dusky titi monkey) (Callicebus moloch)

HMGB1 Proteins for Equus caballus (Horse)

HMGB1 Proteins for Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey)

HMGB1 Proteins for Canis lupus familiaris (Dog) (Canis familiaris)


HMGB1 cDNA for Papio anubis (Olive baboon)

HMGB1 cDNA for Equus caballus (Horse)


HMGB1 ELISA Kit for Bos taurus (Bovine)

HMGB1 ELISA Kit for Canis lupus familiaris (Dog) (Canis familiaris)

HMGB1 ELISA Kit for Equus caballus (Horse)

HMGB1 ELISA Kit for Homo sapiens (Human)

HMGB1 ELISA Kit for Mus musculus (Mouse)

HMGB1 ELISA Kit for Sus scrofa (Pig)

HMGB1 ELISA Kit for Rattus norvegicus (Rat)

Most popular with customers


Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2018 CUSABIO TECHNOLOGY LLC All Rights Reserved.


Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.


Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.