SQSTM1

Code CSB-CL716153PYX
Size 10 μg plasmid + 200μl Glycerol
Uniprot No. Q5RBA5
Relevance Pongo abelii sequestosome 1 (SQSTM1), mRNA.
Species Pongo abelii (Sumatran orangutan) (Pongo pygmaeus abelii)
Vector pUC
Sequence atggcgtc gctcaccgtg aaggcctaccttctgggcaa ggaggacgcg gcgcgcgaga ttcgccgctt cagcttctgc tgcagccccgagcctgaggc ggaagccgag gctgcggcgg gtccgggacc ctgcgagcgg ctgctgagccgggtggccgc cctgttcccc gcgctgcggc ctggcggctt ccaggcgcac taccgcgatgaggacgggga cttggttgcc ttttccagtg acgaggaatt gacaatggcc atgtcctacgtgaaggatga catcttccga atctacatta aagagaaaaa agagtgccgg cgggaccaccgcccaccgtg tgctcaggag gcgccccgca acatggtgca ccccaatgtg atctgcgatggctgcaatgg gcctgtggta ggaacccgct acaagtgcag cgtctgccca gactacgacttgtgtagcgt ctgcgaggga aagggcttgc accgggggca caccaagctc gcattccccagccccttcgg gcacctgtct gagggcttct cgcacagccg ctggctccgg aaggtgaaacacggacactt cgggtggtca ggatgggaaa tgggtccacc aggaaactgg agcccacgtcctcctcgtgc aggggaggcc cgccctggcc ccacggcaga atcagcttct ggtccatcggaggatccgag tgtgaatctc ctgaagaacg ttggggagag tgtggcagct gcccttagccctctgggcat tgaagttgat atcgatgtgg agcacggagg gaaaagaagc cgcctgacccccgtctctcc agagagttcc agcacagagg agaagagcag ctcacagcca agcagctgctgctctgaccc cagcaagccg ggtgggaatg ttgagggcgc cacgcagtct ctggcggagcagatgaggaa gatcgccttg gagtccgagg ggcgccctga ggaacagatg gagtcggataactgttcagg aggagatgat gactggaccc atctgtcttc aaaagaagtg gacccgtctacaggtgaact ccagtcccta cagatgccag aatccgaagg gccaagctct ctggacccctcccaggaggg acccacaggg ctgaaggaag ctgccttgta cccacatctc ccgccagaggctgacccgcg gctgattgag tccctctccc agatgctgtc catgggcttc tctgatgaaggcggcaggct caccaggctc ctgcagacca agaactatga catcggagcg gctctggacaccatccagta ttcaaagcat cccccgccgt tgtga
Gene Names SQSTM1
Accession NO. NM_001132076.1
Still Have Questions? Leave a Message or Start an on-line Chat
Function Autophagy receptor that interacts directly with both the cargo to become degraded and an autophagy modifier of the MAP1 LC3 family. Required both for the formation and autophagic degradation of polyubiquitin-containing bodies, called ALIS (aggresome-like induced structures) and links ALIS to the autophagic machinery. Involved in midbody ring degradation (By similarity). May regulate the activation of NFKB1 by TNF-alpha, nerve growth factor (NGF) and interleukin-1. May play a role in titin/TTN downstream signaling in muscle cells. May regulate signaling cascades through ubiquitination. Adapter that mediates the interaction between TRAF6 and CYLD (By similarity). May be involved in cell differentiation, apoptosis, immune response and regulation of K(+) channels. Involved in endosome organization by retaining vesicles in the perinuclear cloud
Subcellular Location Cytoplasm, cytosol, Late endosome, Nucleus, Endoplasmic reticulum, Lysosome, Cytoplasmic vesicle, autophagosome, Nucleus, PML body, Cytoplasm, myofibril, sarcomere
Database Links

UniGene: Pab.13510

Pathway Necroptosis
Mitophagy
Cellular senescence
Osteoclast differentiation

Related Products

SQSTM1 Antibodies

SQSTM1 Antibodies for Homo sapiens (Human)

SQSTM1 Proteins

SQSTM1 Proteins for Rattus norvegicus (Rat)

SQSTM1 Proteins for Homo sapiens (Human)

SQSTM1 Proteins for Pongo abelii (Sumatran orangutan) (Pongo pygmaeus abelii)

SQSTM1 Proteins for Mus musculus (Mouse)

SQSTM1 cDNA

SQSTM1 cDNA for Rattus norvegicus (Rat)

SQSTM1 cDNA for Homo sapiens (Human)

Most popular with customers

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2018 www.cusabio.com CUSABIO TECHNOLOGY LLC All Rights Reserved.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.