Tel : 301-363-4651 Professional and Accurate! We are your good partner in biology research.

Product Name:

SQSTM1 cDNA Clone

Product Type : Clone
Code : CSB-CL723738MO
Size : 10 μg plasmid + 200μl Glycerol
Relevance : Codon optimization for expression in E.coli
Alias : A170, STAP
Sample Types : PUC
Sequence : GCAAGCTTTACCGTTAAAGCATATCTGCTGGGTAAAGAAGAAGCAACACGCGAAATTCGTCGTTTTAGCTTTTGTTTTAGTCCGGAACCGGAAGCAGAAGCACAGGCAGCAGCAGGTCCGGGTCCGTGTGAACGTCTGCTGAGCCGTGTTGCAGTTCTGTTTCCGACCCTGCGTCCGGGTGGTTTTCAGGCACATTATCGTGATGAAGATGGTGATCTGGTTGCATTTAGCTCAGATGAAGAACTGACCATGGCAATGAGCTATGTGAAAGATGATATTTTCCGCATCTATATCAAAGAAAAAAAAGAGTGCCGTCGCGAACATCGTCCTCCGTGTGCACAAGAGGCACCGCGTAATATGGTTCATCCGAATGTTATTTGTGATGGTTGTAATGGTCCGGTTGTTGGCACCCGTTATAAATGTAGCGTTTGTCCGGATTATGATCTGTGCAGCGTTTGTGAAGGTAAAGGTCTGCATCGTGAACATAGCAAACTGATTTTTCCGAATCCGTTTGGTCATCTGAGTGATAGCTTTAGCCATAGCCGTTGGCTGCGTAAACTGAAACATGGTCATTTTGGTTGGCCTGGTTGGGAAATGGGTCCGCCTGGTAATTGGAGTCCGCGTCCGCCTCGTGCCGGTGATGGTCGTCCGTGTCCGACCGCAGAAAGCGCAAGCGCACCGCCTGAAGATCCGAACGTTAATTTTCTGAAAAATGTGGGTGAAAGCGTTGCAGCAGCACTGAGTCCGCTGGGTATTGAAGTTGATATTGATGTTGAACATGGTGGTAAACGTAGCCGTCTGACCCCGACCACACCGGAAAGCAGCAGTACCGGCACCGAAGATAAAAGCAATACACAGCCGAGCAGCTGTAGCAGCGAAGTTAGCAAACCGGATGGTGCGGGTGAAGGTCCGGCACAGAGCCTGACCGAGCAGATGAAAAAAATCGCACTGGAAAGCGTGGGTCAGCCGGAAGAACAAATGGAAAGCGGTAATTGTAGCGGTGGTGATGATGATTGGACCCATCTGAGCAGCAAAGAAGTTGATCCGAGCACCGGTGAACTGCAGAGCCTGCAGATGCCGGAAAGCGAAGGTCCGAGCAGCCTGGATCCGAGCCAAGAAGGTCCTACCGGTCTGAAAGAAGCAGCCCTGTATCCGCATCTGCCTCCGGAAGCCGATCCGCGTCTGATTGAAAGCCTGAGCCAGATGCTGAGCATGGGTTTTTCTGATGAAGGTGGTTGGCTGACCCGTCTGCTGCAGACCAAAAACTATGATATTGGTGCAGCACTGGATACCATCCAGTATAGCAAACATCCGCCTCCGCTG
Protein Names : 18412
Contact us
Prev product: EHMT2
Next product: secA cDNA Clone

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2015 www.cusabio.com Cusabio Biotech Co., Ltd All Rights Reserved.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.