sox9

Code CSB-CL738696XBF
Size 10 μg plasmid + 200μl Glycerol
Uniprot No. Q6F2E7
Relevance Xenopus (Silurana) tropicalis SRY (sex determining region Y)-box 9 (sox9), mRNA.
Alias cmd1; cmpd1; sox-9; sra1; Xt-sox9
Species Xenopus tropicalis (Western clawed frog) (Silurana tropicalis)
Vector pUC
Sequence atgaatctcttggatccc ttcatgaaga tgacagaaga gcaagataag tgcatgtccg gggcccccagcccaacaatg tccgaggact cggctggctc cccatgcccc tccggctctg gctccgacacggagaacacc agaccccaag agaacacttt ccccaaaggg gacccggagc tgaagaaggagacagaggac gaaaagtttc ctgtgtgcat cagagaggcg gtcagccagg tgctgaagggatatgactgg accctggtac cgatgccagt cagagttaat ggatccagca agagcaagcctcatgtcaag agacccatga acgccttcat ggtgtgggca caggctgcaa ggaggaagctggccgaccaa tacccccatc tgcacaatgc agaactcagc aagactctgg gcaagttatggagacttctg aatgagggcg agaaacgccc tttcgtggag gaagcagaga ggctgcgaatccaacataag aaggatcatc cagactacaa gtaccagcca cggcgcagaa agtccgtaaagaatgggcag tcagaacaag aggacggcgc tgagcaaacc cacatctccc ctaatgccatttttaaggcc ctgcaggctg attccccaca ttctgcctcc agcatgagcg aagtccactctcctggagaa cattcaggtc agtcccaagg cccaccaact cctccaacta cccccaagacagacgtccag cctggaaagc cagacctgaa gagggagggc aggccactgc aggagagcggtaggcagcca cctcacatcg atttccgaga tgtagatatt ggtgaactga gcagtgaggtcatctctacc atcgaaacct ttgatgtcaa tgaatttgac caatacctgc cacccaatggccacccaggt gttggctcca cacaggcccc atacacaggc agttatggca tcaacagcacccccagcgct actccgggtg ctggccctgc ctggatgtct aaacaacaac agcagcagcagcaacaacca cagcctcccc aacactcact gtcaaccata aacagcgagc aaagccagtcccagcaaagg acacacatca agactgaaca actgagccct agccattaca gtgaccagcagcaacagcac tccccccagc agctgaacta cagctccttc aacctgcagc attacagctcttcctaccca accattaccc gtgcccagta tgactacaca gagcaccaag gctccaactcttattacagt cacgcaagcg gtcagaattc tggtctctac tccaacttta gctacatgaatccaagccag cgccccatgt acacgcctat tgcagacacg acgggagttc catccatcccccagacacac agcccacaac actgggagca gcctgtctat acacagctca ccaggccctag
Gene Names sox9
Accession NO. NM_001016853.2
Still Have Questions? Leave a Message or Start an on-line Chat
Function Transcription activator. Acts early in neural crest formation, functioning redundantly with the other group E Sox factors sox8 and sox10 to induce neural crest progenitors. Induces sox10 expression downstream of wnt-signaling. Principally involved in development of the cranial neural crest, which is fated to form skeletal elements. Also required for otic placode specification during inner ear development (By similarity). May be involved in chondrogenesis (cartilage development) during bone formation. Unlikely to play a role in sex determination but may function during testicular and ovarian differentiation.
Subcellular Location Nucleus, Cytoplasm
Tissue Specificity Expressed in both male and female gonads from after metamorphosis through to adult stages. In the testis, expression is restricted to the supporting Sertoli-like cells. Conversely in the ovary, expression is localized to primary oocytes (at protein level)
Database Links

KEGG: xtr:549607

UniGene: Str.15584

Pathway cAMP signaling pathway

Related Products

sox9 Antibodies

sox9 Antibodies for Homo sapiens (Human)

sox9 Proteins

sox9 Proteins for Gallus gallus (Chicken)

sox9 Proteins for Homo sapiens (Human)

sox9 Proteins for Macaca mulatta (Rhesus macaque)

sox9 Proteins for Sus scrofa (Pig)

sox9 Proteins for Pongo pygmaeus (Bornean orangutan)

sox9 Proteins for Xenopus tropicalis (Western clawed frog) (Silurana tropicalis)

sox9 Proteins for Canis lupus familiaris (Dog) (Canis familiaris)

sox9 Proteins for Pan troglodytes (Chimpanzee)

sox9 Proteins for Callithrix jacchus (White-tufted-ear marmoset)

sox9 cDNA

sox9 cDNA for Canis lupus familiaris (Dog) (Canis familiaris)

sox9 cDNA for Pan troglodytes (Chimpanzee)

sox9 cDNA for Macaca mulatta (Rhesus macaque)

sox9 cDNA for Sus scrofa (Pig)

Most popular with customers

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2018 www.cusabio.com CUSABIO TECHNOLOGY LLC All Rights Reserved.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.