Tel : 301-363-4651 Professional and Accurate! We are your good partner in biology research.

Gene Synthesis Services

One-stop service of gene, cloning, point mutations :

Our synthesis technology is not reliant on PCR
Many difficult gene synthesis methods
Codon optimization service for free
Competitive price

Fast: fastest five working days delivery for simple gene under 1Kb
Stable: complete project management, stable production process
Accurate: sequence is 100% correct; NanoDrop 2000c accurate determination of concentration and purity
Resolute: difficult gene, synthesis advantage

Final delivery :

2-4 μg high purity plasmid (the default vector pUC57), piercing bacteria, sequencing report, COA report, sqd files

Case :

{CAC}82

{GGGTTA}42

{GGTCCTCCGCCTCCTCCACCTC}6

{GCTTCCCCCTG}10

Vector Construction Services :

ShRNA vector construction
RNA interference (RNAi) refers to the phenomenon that the evolution is high conserved, double-stranded RNA induces homologous mRNA specificity degradation. Cusabio provides you with efficient, fast shRNA vector construction service, and constructs the target sequence into the expression vector in the form of hairpin. It can transcribe continuously & efficiently and process to produce effector molecules, finally ensuring the interference efficiency on the great degree.

Advantages
Characteristics: After expression, the target protein was purified by nickel column affinity chromatography. The purity reached 90%, and the yield reached 20 mg/L

  • ShRNA vector construction, 100% pass the hairpin area, failed construction does not charge any fees;
  • For anthropogenic gene, Cusabio designs the target spot and ensures more than 70% interference efficiency;
  • DIY construction, we can design and countrcut the vector according to your special demand.

Your satisfaction is our final goal !

In addition, we also provide you with a variety of value cloning and expression vector construction services.

vector construction services
ShRNA vectorcloning vectorexpression vectormicroRNA overexpression vectorreporter genevector
Point Mutation Services :

We generally use PCR technology to do directional or random mutations for mutation sites on the basis of guaranteeing fidelity in original sequence, types including bases addition, deletion, mutations etc. It is the common research means of genetic evolution, protein engineering, enzyme engineering etc.

Advantages
  • Absolutely guarantee the fidelity in the area of gene without mutation and vector
  • All mutations within 24 bp for one step and we only charge the fees of one site
  • Normative, strict standards of quality controlling

Newsletters

Get all the lasted information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2015 www.cusabio.com Cusabio Biotech Co., Ltd All Rights Reserved.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.