Nucleotide Reverse Complement Tool

Enter a nucleic acid sequence, select conversion type, and get the corresponding result

Length: 0
Conversion result will appear here...
Length: 0

Conversion Info

Sequence Type: DNA

Conversion Type: Reverse Complement Sequence

Sequence Analysis

Sequence analysis will display here after conversion...

Base Pairing Rules

DNA Base Pairing

A Adenine
T Thymine
C Cytosine
G Guanine

RNA Base Pairing

A Adenine
U Uracil
C Cytosine
G Guanine

About the Sequence Conversion Tool

Learn about the principles of nucleic acid sequence reverse complement conversion and the features of this tool

Conversion Principles

Reverse complement conversion of nucleic acid sequences is a fundamental operation in molecular biology. The reverse sequence is the original sequence in reverse order. The complementary sequence is generated based on base pairing rules, and the reverse complement sequence is the complementary sequence in reverse order.

Features

Supports three conversion modes for DNA and RNA sequences, automatically processes common impurity characters in sequences, displays real-time sequence analysis results, supports result copying and downloading, and provides sample sequences for quick testing.

Applications

Suitable for PCR primer design, gene cloning, sequence alignment, molecular biology experiment design and other scenarios, helping researchers quickly generate and analyze the reverse complement strands of nucleic acid sequences.

How to Use

Learn how to use this tool to perform reverse complement conversion of nucleic acid sequences

1 Enter Nucleic Acid Sequence

Paste or type your nucleic acid sequence into the input box. The sequence can contain standard DNA bases (A, T, C, G) or RNA bases (A, U, C, G), case-insensitive. Spaces, numbers, and other non-base characters are allowed and will be automatically filtered.

Valid sequence examples:

ATGCCTAGCTAGCTAGCTAG

augccuagcuagcuagcuag

ATGC (123) TAGC

2 Select Conversion Options

  • Select sequence type: DNA or RNA
  • Select conversion type: Reverse Sequence, Complementary Sequence, or Reverse Complement Sequence
  • Choose whether to auto-convert and whether to output in uppercase

3 View Conversion Results

The tool will generate the corresponding converted sequence based on your selected options and display it in the output area. Sequence analysis information, including sequence length, base composition, and GC content, is also provided.

Conversion result example:

CTAGCTAGCTAGCTAGGCAT

4 Save or Analyze Results

  • Click the "Copy" button to copy the converted sequence
  • Click the "Download" button to save the sequence as a text file
  • Click the "Analyze" button for more detailed sequence analysis
📺Tutorial Video

To help you make the most of the Nucleotide Reverse Complement Tool, we’ve prepared a short demonstration video. Watch it below to see how to quickly generate reverse complement sequences for DNA or RNA, and learn tips for accurate sequence analysis.

icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 7 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2025 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1