Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
Length: 0
Translation results will appear here...
Length: 0
Translation Info
Genetic Code Table: Standard (1)
Codon Preference: Always First
Start Codon: ATG
Stop Codon: TAA
DNA Sequence Analysis
Sequence analysis will appear after translation...
Amino Acid to Codon Table
| Amino Acid | Codons | Non-degenerate Choice |
|---|
About Protein to DNA Sequence Converter
Understand the basic principles of non-degenerate DNA sequence generation and the features of this tool
Translation Principle
This tool converts protein sequences to DNA sequences based on genetic code tables. Unlike random codon selection, non-degenerate translation selects a fixed codon for each amino acid to ensure consistency of results.
Features
Supports multiple genetic code tables, provides three codon preference strategies (always first, GC-rich, AT-rich), allows custom inclusion of start and stop codons, and offers sequence analysis functions.
Applications
Suitable for gene synthesis, protein expression optimization, gene cloning, gene editing and other research, especially for experimental designs that require ensuring the consistency of DNA sequences.
How to Use
Learn how to use this tool to convert protein sequences to DNA sequences
1 Enter Protein Sequence
Paste or type the protein sequence in the input box. The sequence can contain standard single-letter abbreviations for the 20 amino acids (A, R, N, D, etc.), case-insensitive.
Valid sequence example:
MFVKTLGRTLSAA
2 Select Translation Options
- Choose an appropriate genetic code table
- Select a codon preference strategy
- Choose whether to include start and stop codons
3 View Translation Results
The tool will generate the corresponding non-degenerate DNA sequence and provide sequence analysis information, including length, GC content, etc.
DNA sequence example:
ATGTTTGTGAAGACGCTGGGCAGAACCCTGAGCGCCGCC
4 Save or Analyze Results
- Click the "Copy" button to copy the DNA sequence
- Click the "Download" button to save as a text file
- Click the "Analyze" button to get more sequence characteristics
📺Tutorial Video
Watch this quick demo to learn how to convert a protein sequence to DNA, step by step, using our Protein to DNA Sequence Converter.
