Product Details

Purity

Greater than 85% as determined by SDS-PAGE.

Target Names

FXYD3

Uniprot No.

Q14802

Research Area

Cancer

Alternative Names

Chloride conductance inducer protein Mat 8; Chloride conductance inducer protein Mat-8; FXYD domain containing ion transport regulator 3; FXYD domain-containing ion transport regulator 3; Fxyd3; FXYD3_HUMAN; Mammary tumor 8 kDa protein; MAT-8; MAT8; MGC111076; Phospholemman like; Phospholemman-like; PLML

Species

Homo sapiens (Human)

Source

E.coli

Expression Region

21-38aa

Target Protein Sequence

AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG
Note: The complete sequence may include tag sequence, target protein sequence, linker sequence and extra sequence that is translated with the protein sequence for the purpose(s) of secretion, stability, solubility, etc.
If the exact amino acid sequence of this recombinant protein is critical to your application, please explicitly request the full and complete sequence of this protein before ordering.

Mol. Weight

20.5 kDa

Protein Length

Partial

Tag Info

N-terminal 6xHis-SUMO-tagged

Form

Liquid or Lyophilized powder
Note: We will preferentially ship the format that we have in stock, however, if you have any special requirement for the format, please remark your requirement when placing the order, we will prepare according to your demand.

Buffer

If the delivery form is liquid, the default storage buffer is Tris/PBS-based buffer, 5%-50% glycerol.
Note: If you have any special requirement for the glycerol content, please remark when you place the order.
If the delivery form is lyophilized powder, the buffer before lyophilization is Tris/PBS-based buffer, 6% Trehalose.

Reconstitution

We recommend that this vial be briefly centrifuged prior to opening to bring the contents to the bottom. Please reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.We recommend to add 5-50% of glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default final concentration of glycerol is 50%. Customers could use it as reference.

Troubleshooting and FAQs

Protein FAQs

Storage Condition

Store at -20°C/-80°C upon receipt, aliquoting is necessary for mutiple use. Avoid repeated freeze-thaw cycles.

Shelf Life

The shelf life is related to many factors, storage state, buffer ingredients, storage temperature and the stability of the protein itself.
Generally, the shelf life of liquid form is 6 months at -20°C/-80°C. The shelf life of lyophilized form is 12 months at -20°C/-80°C.

Lead Time

3-7 business days

Notes

Repeated freezing and thawing is not recommended. Store working aliquots at 4°C for up to one week.

Datasheet & COA

Please contact us to get it.

Description

In the general process of expressing the recombinant Human FXYD3 protein, a plasmid encoding the Human FXYD3 protein (21-38aa) is constructed first. The plasmid is transferred into e.coli cells, from which cells containing the plasmid are selected and cultured to express the protein. A N-terminal 6xHis-SUMO tag is fused to the protein. The recombinant Human FXYD3 protein undergoes affinity purification purification and SDS-PAGE analysis. This protein surpasses a purity level of 85%.

Target Background

Function

Associates with and regulates the activity of the sodium/potassium-transporting ATPase (NKA) which transports Na(+) out of the cell and K(+) into the cell. Reduces glutathionylation of the NKA beta-1 subunit ATP1B1, thus reversing glutathionylation-mediated inhibition of ATP1B1. Induces a hyperpolarization-activated chloride current when expressed in Xenopus oocytes.; Decreases the apparent K+ and Na+ affinity of the sodium/potassium-transporting ATPase over a large range of membrane potentials.; Decreases the apparent K+ affinity of the sodium/potassium-transporting ATPase only at slightly negative and positive membrane potentials and increases the apparent Na+ affinity over a large range of membrane potentials.

Gene References into Functions

Suppression of FXYD3 in MCF-7. PMID: 26740212
All three markers correlated significantly with regional lymph node metastasis: FXYD3 (p = 0.0110), S100A11 (p = 0.0071), and GSTM3 (p = 0.0173) in colon cancer lymphatic metastasis. PMID: 22430872
ExoS facilitates P. aeruginosa penetration through the intestinal epithelial barrier by binding to FXYD3 and thereby impairing the defense function of tight junctions against bacterial penetration. PMID: 20805335
Up-regulated expression of FXYD-3 protein may be involved in tumourgenesis and invasion of gastric adenocarcinoma. PMID: 20364041
FXYD3 expression is related to several biological variables including ras, p53, legumain and PCNA, and may be involved in the development of the relatively early stages of colorectal cancers PMID: 19955746
Upregulation of FXYD3 is associated with glioma. PMID: 20112499
inactivation of FXYD3 through a gene mutation or unknown mechanism could be one cause of the atypical shapes of cancer cells and play a potential role in the progression of lung cancer. PMID: 19893046
Results indicate that the human MAT-8 gene contains the potential to serve as a prostate cancer expression marker and that MAT-8 plays an important role in cellular growth of prostate carcinomas. PMID: 14654946
overexpression of FXYD3 in pancreatic cancer may contribute to the proliferative activity of this malignancy PMID: 16003754
analysis of two human FXYD3 isoforms that are differentially expressed in differentiated and non-differentiated cells with different functional properties PMID: 17077088
FXYD3 interacts with Na(+)-K(+)-Exchanging ATPase in colorectal neoplasms. PMID: 17409496
structures of the FXYD proteins (with emphasis on 1-4), as well as their dynamics and their associations with the lipid PMID: 18000745
FXYD3 silencing prevents proper regulation of Na,K-ATPase, which leads to perturbation of cellular Na+ and K+ homeostasis and changes in the expression of Na,K-ATPase isozymes, whose functional properties are incompatible with cell differentiation. PMID: 19109419
FXYD3a protein is highly expressed in breast cancers, and responsible for cancer cell proliferation. PMID: 19571376

Hide All

Subcellular Location

Cell membrane; Single-pass type I membrane protein.

Protein Families

FXYD family

Tissue Specificity

Isoform 1: Expressed mainly in differentiated cells (at protein level). Isoform 2: Expressed mainly in undifferentiated cells (at protein level).

Database Links

HGNC: 4027

OMIM: 604996

KEGG: hsa:5349

STRING: 9606.ENSP00000389770

UniGene: Hs.301350

Message

Product >> Product Name：
Product >> Code：
Name： *
Email： *
Company/Organization：
Phone：
Since emails may get flagged by spam filters occasionally, we recommend leaving your phone number as a precaution. Your information is safe with us.
Question/Comment： *
Your Region： *
I'd like to receive email newsletters from Cusabio

Yes

No
How do you know CUSABIO?

Email

Distributor

Search engine

Advertisement

Others
CAPTCHA verification：
If CAPTCHA verification fails, click to refresh the CAPTCHA and try again.

Code	CSB-EP622789HU
Abbreviation	Recombinant Human FXYD3 protein, partial
MSDS	MSDS Datasheet
Size	US$306
	Order now
Image	(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.
Have Questions?	Leave a Message or Start an on-line Chat

Recombinant Human FXYD domain-containing ion transport regulator 3 (FXYD3),Partial

Product Details

Related Products

Customer Reviews and Q&A

Target Background

×CloseMessage