| Code | CSB-EP748739SCG |
| MSDS | |
| Size | Pls inquire |
| Source | E.coli |
| Have Questions? | Leave a Message or Start an on-line Chat |
| Code | CSB-EP748739SCG-B |
| MSDS | |
| Size | Pls inquire |
| Source | E.coli |
| Conjugate | Avi-tag Biotinylated E. coli biotin ligase (BirA) is highly specific in covalently attaching biotin to the 15 amino acid AviTag peptide. This recombinant protein was biotinylated in vivo by AviTag-BirA technology, which method is BriA catalyzes amide linkage between the biotin and the specific lysine of the AviTag. |
| Have Questions? | Leave a Message or Start an on-line Chat |
| Code | CSB-BP748739SCG |
| MSDS | |
| Size | Pls inquire |
| Source | Baculovirus |
| Have Questions? | Leave a Message or Start an on-line Chat |
| Code | CSB-MP748739SCG |
| MSDS | |
| Size | Pls inquire |
| Source | Mammalian cell |
| Have Questions? | Leave a Message or Start an on-line Chat |
There are currently no reviews for this product.
Could you share what kind of yeast you use to produce saporin 9 (CSB-YP748739SCG)?
The strain that we use for Yeast expression system is Pichia pastoris.
During the process, does your company optimize Yeast Condon?
Yes, we do.
Could you share nucleotide sequence information for this protein (CSB-YP748739SCG)?
GTTACCTCCATCACCTTGGACTTGGTTAACCCAACTGCTGGTCAGTACTCCTCATTCGTCGACAAGATCAGAAACAACGTCAAGGACCCAAACCTGAAGTACGGTGGTACTGACATTGCTGTTATTGGTCCACCATCCAAGGACAAGTTCTTGAGAATCAACTTCCAGTCCTCCAGAGGTACTGTCTCCTTGGGTTTGAAGAGAGACAACTTGTACGTCGTTGCCTACTTGGCTATGGACAACACCAACGTTAACAGAGCCTACTACTTCAGATCCGAGATCACTTCCGCTGAGTTGACTGCTTTGTTCCCAGAAGCTACTGCTGCTAACCATAAGGCTTTGGAGTACACTGAGGACTACCACTCCATTGAGAAGAACGCTCAGATTACCGAAGGTGACAAGTCCAGAAAAGAGCTTGGTCTGGGTATCAACTTGTTGTCCTCCACTATGGACACCGTCAACAAGAAGGTTAGAGTCGTTAAGAACGAGGCCAGGTTCTTGCTGATTGCTATCCAAATGACTGCTGAGGCCGTCAGATTCAGGTACATCCAGAACTTGGTCACCAAGAACTTCCCCAACAAGTTCAACTCCGAGAACAAGGTCATCAAGTTCGAGGTCAACTGGAAGAAGATCTCCACTGCTATTCACGGTGACGCCAAGAACGGTGTTTTCAACAAGGATTACGACTTCGGTTTCGGTAAGGTCAGACTGGTTAAGGACTTGCAGATGGGTTTGTTGATGCACTTGGGTAAGCCAAAG
After generating the protein (CSB-YP748739SCG), does your company confirm the sequence of every protein using Sanger or other methods?
Yes, after the construction of expression plasmid, sequencing will be performed to ensure that the nucleotide sequence is consistent with the designed sequence.
Could you share the plasmids of the items with us?
The plasmids of the original Saporin9 is not for sale. Since the sequence-modified ones are custom proteins for you, if you order 1mg of each proteins, we can provide the plasmids along with the Concluding Report, but there will be extra cost.
I was wondering if you could ship it to us in liquid form after purification. Do NOT lyophilize because we are concerned that drying the protein affects its functionality. Is it active form of toxin?
Yes, we can ship this protein in liquid form. We haven't expressed this protein yet, its activity is not guaranteed. In theory, this is a full length protein and we adopt affinity chromatography for purification, which is purified under a very mild condition, it's very likely to be active.