Prnp Antibody

Rare Species
Code CSB-PA018739LA01RA
Size US$166
Order now
Have Questions? Leave a Message or Start an on-line Chat

Product Details

Full Product Name
Rabbit anti-Rattus norvegicus (Rat) Prnp Polyclonal antibody
Uniprot No.
Target Names
Alternative Names
Prnp antibody; Prn antibody; Prp antibody; Major prion protein antibody; PrP antibody; CD antigen CD230 antibody
Raised in
Rabbit
Species Reactivity
Rat
Immunogen
Recombinant Rat Major prion protein (29-231AA)
Immunogen Species
Rattus norvegicus (Rat)
Conjugate
Non-conjugated

The Prnp Antibody (Product code: CSB-PA018739LA01RA) is Non-conjugated. For Prnp Antibody with conjugates, please check the following table.

Available Conjugates
Conjugate Product Code Product Name Application
HRP CSB-PA018739LB01RA Prnp Antibody, HRP conjugated ELISA
FITC CSB-PA018739LC01RA Prnp Antibody, FITC conjugated
Biotin CSB-PA018739LD01RA Prnp Antibody, Biotin conjugated ELISA
Clonality
Polyclonal
Isotype
IgG
Purification Method
>95%, Protein G purified
Concentration
It differs from different batches. Please contact us to confirm it.
Buffer
Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4
Form
Liquid
Tested Applications
ELISA
Protocols
Troubleshooting and FAQs
Storage
Upon receipt, store at -20°C or -80°C. Avoid repeated freeze.
Lead Time
Basically, we can dispatch the products out in 1-3 working days after receiving your orders. Delivery time maybe differs from different purchasing way or location, please kindly consult your local distributors for specific delivery time.
Usage
For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Customer Reviews and Q&A

 Customer Reviews

There are currently no reviews for this product.

Submit a Review here

Target Background

Function
Its primary physiological function is unclear. May play a role in neuronal development and synaptic plasticity. May be required for neuronal myelin sheath maintenance. May promote myelin homeostasis through acting as an agonist for ADGRG6 receptor. May play a role in iron uptake and iron homeostasis. Soluble oligomers are toxic to cultured neuroblastoma cells and induce apoptosis (in vitro). Association with GPC1 (via its heparan sulfate chains) targets PRNP to lipid rafts. Also provides Cu(2+) or ZN(2+) for the ascorbate-mediated GPC1 deaminase degradation of its heparan sulfate side chains.
Gene References into Functions
  1. the mechanism by which stressful stimuli induced by opiate withdrawal and the subsequent long-term homeostatic changes in hippocampal plasticity, modulate the expression and the dynamics of Prion protein. PMID: 28081197
  2. The results suggest a role of PrP(C) in proteostasis, dysfunctions of which may be involved in the pathogenesis of neurodegenerative diseases such as TSE and Alzheimer's Disease. PMID: 26946358
  3. this study implies that lithium, the commonly used mood stabilizer, may be a promising therapeutic agent in TSE, particularly in case of the disease forms associated with accumulation of cytoPrP. PMID: 26149502
  4. We provide the first report that mean PrPC concentration in primary blast exposed rats is significantly increased compared with controls PMID: 25058115
  5. data provide new insights into the cellular mechanism of prion conversion and suggest that GM1-prion protein interaction at the cell surface could play a significant role in the mechanism predisposing to pathology. PMID: 24859148
  6. The toxicity of PrP(111-126) to cultured astrocytes was reduced following the addition of Cu(2+) ions, owing to binding affinity of copper towards histidine moiety present in the peptide. PMID: 24386462
  7. Down regulation of brain cellular prion protein in an animal model of insulin resistance. PMID: 24780399
  8. PrP(106-126) cytotoxic amyloid oligomers disruption of membranes is dependent on bilayer composition PMID: 24554723
  9. Prion protein-mediated toxicity of amyloid-beta oligomers requires lipid rafts and the transmembrane LRP1 PMID: 23386614
  10. The study suggests a pivotal role for PrP(C) in the cell adaptation to copper limitation through a direct activity of ion uptake. PMID: 22362149
  11. The prion protein and mrna was regulaion in vitamin B(12)rats. PMID: 22116041
  12. The nerves of the PrP(C)-treated rats show typical cobalamin-deficient lesions, significantly decreased abnormal maximum nerve conduction velocity values, and significantly increased tumor necrosis factor-alpha levels. PMID: 22102467
  13. mutant or cytosolic PrP expression in transgenic mice and human or rat cells is not associated with endoplasmic reticulum stress or proteasome dysfunction PMID: 21559407
  14. Data demonstrate that PrP(C) is abundant in the nuclear lamina of endocrine and neuronal cells and interacts with histone H1(0), histone H3 and lamin B1. PMID: 21277044
  15. These new data indicate that PrPc gene regulation is highly dependent on disruption of chromatin fiber assembly, which allows some ubiquitous transcription factors accession to specific DNA elements PMID: 11739375
  16. In retinal explants from neonatal mice and rats, engagement of PrP(c) transduces neuroprotective signals through a cAMP/PKA-dependent pathway. PrP(c) may function as a trophic receptor, the activation of which leads to a neuroprotective state. PMID: 12093733
  17. Two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. PMID: 12392052
  18. PrP is not subject to retrotranslocation from the ER into the cytoplasm prior to degradation by the proteasome PMID: 12663673
  19. Various prion glycoforms in B104 neuroblastoma cells were tightly regulated as a function of cell density and during neuronal differentiation. Potential role of cellular prion protein in cell-cell interactions and differentiation. PMID: 12911750
  20. the intrinsic properties of PrP-(82-146) are dependent upon the integrity of the C-terminal region and account for the massive deposition of PrP amyloid in GSS PMID: 12970341
  21. Glycosylphosphatidylinositol-anchored prion protein and Thy-1 were largely clustered in separate domains on the neuronal surface; the lipid content of these membrane domains differed markedly PMID: 14660659
  22. Prion proteins are membrane protein, isolated from neuronal cells, along with Marcks and fyn. PMID: 14741357
  23. PRNP shows no direct CAGA box correspondence with the APP superfamily members. PMID: 15208260
  24. early association of PrP(C) with cholesterol-enriched rafts facilitates its correct folding PMID: 15229281
  25. We propose that this unusual beta-turn-rich form of PrP may be a precursor of PrPSc and a candidate for the neurotoxic molecule in prion pathogenesis. PMID: 15670783
  26. Immunostained cells expressing PrP(c) appear scattered throughout the epithelium of fundic and pyloric glands as well as in intestinal villi and crypts. PMID: 15891070
  27. These results indicate that DRMs are essential for proper trafficking and distribution of PrP(C) at late stages of neuronal differentiation and that its function, at least in hippocampus, is restricted to the axonal domain. PMID: 16139509
  28. Prnp expression is upregulated by copper in neuronal cells by an MTF-1-independent mechanism, and suggest a metal-specific modulation of Prnp in neurons PMID: 16148034
  29. prion protein plasma membrane environment in differentiated neurons resulted to be a complex entity, whose integrity requires a network of lipid-mediated non-covalent interactions PMID: 16248888
  30. Our results indicated a novel PrP(C) interacting protein and suggested that this complex might be relevant in modulating a variety of electrophysiological-dependent cellular responses PMID: 16750514
  31. J protein family serves as a 'folding catalyst' for PrP(C) and implicates Rdj2 as a factor in the protection against prion diseases PMID: 16774738
  32. Pronounced cytosolic aggregation of cellular prion protein in pancreatic beta-cells in response to hyperglycemia. PMID: 17146448
  33. Our findings show that, through its interaction with LN, hippocampal PrPc plays a critical role in memory processing and suggest that this role is mediated by activation of both PKA and ERK1/2 signaling pathways. PMID: 17156386
  34. PrP(106-126) aggregates in vitro and this aggregation state is important for its neurotoxicity PMID: 17405933
  35. the plasma membrane localization of PrP(C) and/or of the converted scrapie form might be necessary for the development of a symptomatic disease PMID: 17556367
  36. PrP(C) is widely expressed in a subset of neurons that contain markers of inhibitory populations of cells throughout the rat brain PMID: 17854776
  37. Results demonstrate by immunohistochemical analysis the colocalization of neuroglobin and PrP(c) in the retinal ganglion cell layer. PMID: 19327369
  38. Our data support a significant role for PrP(c) as a response mediator in neuritogenesis and cell differentiation. PMID: 19457127
  39. The peculiar lipid composition and, in particular, the presence of proteins involved in synaptic plasticity, cell adhesion, cytoskeleton regulation and signaling suggest an important physiological role for the PrPC prion domain in neurons. PMID: 19493159
  40. Lipid rafts and clathrin cooperate in the internalization of PrP in epithelial FRT cells PMID: 19503793
  41. distinct N-terminal cleavage products of PrP(c) harbor different biological activities underlying the various phenotypes linking PrP(c) to cell survival. PMID: 19850936

Show More

Hide All

Involvement in disease
Found in high quantity in the brain of humans and animals infected with degenerative neurological diseases such as kuru, Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler syndrome (GSS), scrapie, bovine spongiform encephalopathy (BSE), transmissible mink encephalopathy (TME), etc.
Subcellular Location
Cell membrane; Lipid-anchor, GPI-anchor. Golgi apparatus.
Protein Families
Prion family
Database Links
icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
No. 269, Shendun 5th Road, Donghu Hi-Tech Development Area, Hubei Province, 430206, P.R.China
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2026 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1
Place an order now

I. Product details

*
*
*
*

II. Contact details

*
*

III. Ship To

*
*
*
*
*
*
*

IV. Bill To

*
*
*
*
*
*
*
*