Purity
Greater than 85% as determined by SDS-PAGE.
Alternative Names
Chloride conductance inducer protein Mat 8; Chloride conductance inducer protein Mat-8; FXYD domain containing ion transport regulator 3; FXYD domain-containing ion transport regulator 3; Fxyd3; FXYD3_HUMAN; Mammary tumor 8 kDa protein; MAT-8; MAT8; MGC111076; Phospholemman like; Phospholemman-like; PLML
Species
Homo sapiens (Human)
Expression Region
21-38aa
Target Protein Sequence
AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG
Note: The complete sequence including tag
sequence, target protein sequence and linker sequence could be provided upon request.
Tag Info
N-terminal 6xHis-SUMO-tagged
Form
Liquid or Lyophilized powder
Note: We will preferentially ship the format that
we have in stock, however, if you have any special requirement for the format, please remark your
requirement when placing the order, we will prepare according to your demand.
Buffer
If the delivery form is liquid, the default storage buffer is Tris/PBS-based buffer, 5%-50% glycerol.
Note: If you have any special requirement for the
glycerol content, please remark when you place the order.
If the delivery form is lyophilized powder, the buffer before lyophilization is Tris/PBS-based buffer,
6% Trehalose, pH 8.0.
Reconstitution
We recommend that this vial be briefly centrifuged prior to opening to bring the contents to the bottom. Please reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.We recommend to add 5-50% of glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default final concentration of glycerol is 50%. Customers could use it as reference.
Storage Condition
Store at -20°C/-80°C upon receipt, aliquoting is necessary for mutiple use. Avoid repeated freeze-thaw
cycles.
Shelf Life
The shelf life is related to many factors, storage state, buffer ingredients, storage temperature
and the stability of the protein itself.
Generally, the shelf life of liquid form is 6 months at -20°C/-80°C. The shelf life of lyophilized
form is 12 months at -20°C/-80°C.
Lead Time
3-7 business days
Notes
Repeated freezing and thawing is not recommended. Store working aliquots at 4°C for up to one week.
Datasheet & COA
Please contact us to get it.
Description
In the general process of expressing the recombinant Human FXYD3 protein, a plasmid encoding the Human FXYD3 protein (21-38aa) is constructed first. The plasmid is transferred into e.coli cells, from which cells containing the plasmid are selected and cultured to express the protein. A N-terminal 6xHis-SUMO tag is fused to the protein. The recombinant Human FXYD3 protein undergoes affinity purification purification and SDS-PAGE analysis. This protein surpasses a purity level of 85%.
