Recombinant Human FXYD domain-containing ion transport regulator 3 (FXYD3),Partial

In Stock
Code CSB-EP622789HU
Abbreviation Recombinant Human FXYD3 protein, partial
MSDS
Size US$306
Order now
Image
  • (Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.
Have Questions? Leave a Message or Start an on-line Chat

Product Details

Purity
Greater than 85% as determined by SDS-PAGE.
Target Names
FXYD3
Uniprot No.
Research Area
Cancer
Alternative Names
Chloride conductance inducer protein Mat 8; Chloride conductance inducer protein Mat-8; FXYD domain containing ion transport regulator 3; FXYD domain-containing ion transport regulator 3; Fxyd3; FXYD3_HUMAN; Mammary tumor 8 kDa protein; MAT-8; MAT8; MGC111076; Phospholemman like; Phospholemman-like; PLML
Species
Homo sapiens (Human)
Source
E.coli
Expression Region
21-38aa
Target Protein Sequence
AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG
Note: The complete sequence may include tag sequence, target protein sequence, linker sequence and extra sequence that is translated with the protein sequence for the purpose(s) of secretion, stability, solubility, etc.
If the exact amino acid sequence of this recombinant protein is critical to your application, please explicitly request the full and complete sequence of this protein before ordering.
Mol. Weight
20.5 kDa
Protein Length
Partial
Tag Info
N-terminal 6xHis-SUMO-tagged
Form
Liquid or Lyophilized powder
Note: We will preferentially ship the format that we have in stock, however, if you have any special requirement for the format, please remark your requirement when placing the order, we will prepare according to your demand.
Buffer
If the delivery form is liquid, the default storage buffer is Tris/PBS-based buffer, 5%-50% glycerol.
Note: If you have any special requirement for the glycerol content, please remark when you place the order.
If the delivery form is lyophilized powder, the buffer before lyophilization is Tris/PBS-based buffer, 6% Trehalose.
Reconstitution
We recommend that this vial be briefly centrifuged prior to opening to bring the contents to the bottom. Please reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.We recommend to add 5-50% of glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default final concentration of glycerol is 50%. Customers could use it as reference.
Troubleshooting and FAQs
Storage Condition
Store at -20°C/-80°C upon receipt, aliquoting is necessary for mutiple use. Avoid repeated freeze-thaw cycles.
Shelf Life
The shelf life is related to many factors, storage state, buffer ingredients, storage temperature and the stability of the protein itself.
Generally, the shelf life of liquid form is 6 months at -20°C/-80°C. The shelf life of lyophilized form is 12 months at -20°C/-80°C.
Lead Time
3-7 business days
Notes
Repeated freezing and thawing is not recommended. Store working aliquots at 4°C for up to one week.
Datasheet & COA
Please contact us to get it.
Description

In the general process of expressing the recombinant Human FXYD3 protein, a plasmid encoding the Human FXYD3 protein (21-38aa) is constructed first. The plasmid is transferred into e.coli cells, from which cells containing the plasmid are selected and cultured to express the protein. A N-terminal 6xHis-SUMO tag is fused to the protein. The recombinant Human FXYD3 protein undergoes affinity purification purification and SDS-PAGE analysis. This protein surpasses a purity level of 85%.

Customer Reviews and Q&A

 Customer Reviews

There are currently no reviews for this product.

Submit a Review here

Target Background

Function
Associates with and regulates the activity of the sodium/potassium-transporting ATPase (NKA) which transports Na(+) out of the cell and K(+) into the cell. Reduces glutathionylation of the NKA beta-1 subunit ATP1B1, thus reversing glutathionylation-mediated inhibition of ATP1B1. Induces a hyperpolarization-activated chloride current when expressed in Xenopus oocytes.; Decreases the apparent K+ and Na+ affinity of the sodium/potassium-transporting ATPase over a large range of membrane potentials.; Decreases the apparent K+ affinity of the sodium/potassium-transporting ATPase only at slightly negative and positive membrane potentials and increases the apparent Na+ affinity over a large range of membrane potentials.
Gene References into Functions
  1. Suppression of FXYD3 in MCF-7. PMID: 26740212
  2. All three markers correlated significantly with regional lymph node metastasis: FXYD3 (p = 0.0110), S100A11 (p = 0.0071), and GSTM3 (p = 0.0173) in colon cancer lymphatic metastasis. PMID: 22430872
  3. ExoS facilitates P. aeruginosa penetration through the intestinal epithelial barrier by binding to FXYD3 and thereby impairing the defense function of tight junctions against bacterial penetration. PMID: 20805335
  4. Up-regulated expression of FXYD-3 protein may be involved in tumourgenesis and invasion of gastric adenocarcinoma. PMID: 20364041
  5. FXYD3 expression is related to several biological variables including ras, p53, legumain and PCNA, and may be involved in the development of the relatively early stages of colorectal cancers PMID: 19955746
  6. Upregulation of FXYD3 is associated with glioma. PMID: 20112499
  7. inactivation of FXYD3 through a gene mutation or unknown mechanism could be one cause of the atypical shapes of cancer cells and play a potential role in the progression of lung cancer. PMID: 19893046
  8. Results indicate that the human MAT-8 gene contains the potential to serve as a prostate cancer expression marker and that MAT-8 plays an important role in cellular growth of prostate carcinomas. PMID: 14654946
  9. overexpression of FXYD3 in pancreatic cancer may contribute to the proliferative activity of this malignancy PMID: 16003754
  10. analysis of two human FXYD3 isoforms that are differentially expressed in differentiated and non-differentiated cells with different functional properties PMID: 17077088
  11. FXYD3 interacts with Na(+)-K(+)-Exchanging ATPase in colorectal neoplasms. PMID: 17409496
  12. structures of the FXYD proteins (with emphasis on 1-4), as well as their dynamics and their associations with the lipid PMID: 18000745
  13. FXYD3 silencing prevents proper regulation of Na,K-ATPase, which leads to perturbation of cellular Na+ and K+ homeostasis and changes in the expression of Na,K-ATPase isozymes, whose functional properties are incompatible with cell differentiation. PMID: 19109419
  14. FXYD3a protein is highly expressed in breast cancers, and responsible for cancer cell proliferation. PMID: 19571376

Show More

Hide All

Subcellular Location
Cell membrane; Single-pass type I membrane protein.
Protein Families
FXYD family
Tissue Specificity
Isoform 1: Expressed mainly in differentiated cells (at protein level). Isoform 2: Expressed mainly in undifferentiated cells (at protein level).
Database Links

HGNC: 4027

OMIM: 604996

KEGG: hsa:5349

STRING: 9606.ENSP00000389770

UniGene: Hs.301350

icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 7 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2026 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1
Place an order now

I. Product details

*
*
*
*

II. Contact details

*
*

III. Ship To

*
*
*
*
*
*
*

IV. Bill To

*
*
*
*
*
*
*
*