HMBS Antibody

Code CSB-PA010524GA01HU
Size $600
Order now
Have Questions? Leave a Message or Start an on-line Chat

Product Details

Uniprot No.
Target Names
HMBS
Alternative Names
HEM3_HUMAN antibody; HMBS antibody; Hydroxymethylbilane synthase antibody; PBG D antibody; PBG-D antibody; PBGD antibody; PORC antibody; Porphobilinogen deaminase antibody; porphyria, acute, Chester type antibody; Pre uroporphyrinogen synthase antibody; Pre-uroporphyrinogen synthase antibody; UPS antibody; Uroporphyrinogen I synthase antibody; Uroporphyrinogen I synthetase antibody
Raised in
Rabbit
Species Reactivity
Human,Mouse,Rat
Immunogen
Human HMBS
Immunogen Species
Homo sapiens (Human)
Isotype
IgG
Purification Method
Antigen Affinity purified
Concentration
It differs from different batches. Please contact us to confirm it.
Buffer
PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20°C, Avoid freeze / thaw cycles.
Tested Applications
ELISA,WB,IF
Troubleshooting and FAQs
Storage
Upon receipt, store at -20°C or -80°C. Avoid repeated freeze.
Lead Time
Basically, we can dispatch the products out in 1-3 working days after receiving your orders. Delivery time maybe differs from different purchasing way or location, please kindly consult your local distributors for specific delivery time.
Usage
For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Customer Reviews and Q&A

 Customer Reviews

There are currently no reviews for this product.

Submit a Review here

Target Background

Function
As part of the heme biosynthetic pathway, catalyzes the sequential polymerization of four molecules of porphobilinogen to form hydroxymethylbilane, also known as preuroporphyrinogen. Catalysis begins with the assembly of the dipyrromethane cofactor by the apoenzyme from two molecules of porphobilinogen or from preuroporphyrinogen. The covalently linked cofactor acts as a primer, around which the tetrapyrrole product is assembled. In the last step of catalysis, the product, preuroporphyrinogen, is released, leaving the cofactor bound to the holodeaminase intact.
Gene References into Functions
  1. In a Chinese female patient with very typical Acute intermittent porphyria symptoms, a heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. PMID: 30212967
  2. Human hydroxymethylbilane synthase: Molecular dynamics of the pyrrole chain elongation identifies step-specific residues that cause acute intermittent porphyria. PMID: 29632172
  3. After a diagnostic odyssey, his urine porphobilinogen was found to be significantly elevated and genetic testing showed a previously unreported consensus splice-site mutation IVS4-1G>A in the HMBS gene confirming the diagnosis of Acute Intermittent Porphyria (AIP) PMID: 27769855
  4. The authors describe the biochemical characterisation of expressed HMBS mutants in a black South African population. This reveals insight into the mechanism of catalytic activity loss, which may inspire investigation into individualised therapy based on the molecular lesion identified. PMID: 27849156
  5. ALAS1 mRNA and activity were elevated approximately ~3- and 5-fold, and HMB synthase activity was approximately half-normal (~42%) PMID: 26062020
  6. A new mutation in intron 2 (IVS2-2Ag-->G) was identified in a Chinese family with acute intermittent porphyria. PMID: 26228342
  7. in the hepatic cancer tissue of two acute porphyria patients, somatic second-hit mutations result in nearly complete inactivation of PPOX and HMBS PMID: 25445397
  8. study of hydroxymethylbilane synthase mutations and polymorphisms in Brazilian families with acute intermittent porphyria PMID: 25703257
  9. Letter/Case Report: R173W mutation of HMBS gene can cause rhabdomyolysis in patients with variant acute intermittent porphyria. PMID: 25389600
  10. we report a novel PBGD missense mutation. PMID: 25870942
  11. Novel porphobilinogen deaminase gene mutations have been described in Polish patients with non-erythroid acute intermittent porphyria. PMID: 25923088
  12. Conformational stability and activity of hydroxymethylbilane synthase (HMSB) and the acute intermittent porphyria K132N and V215E HMSB mutations. PMID: 23815679
  13. Dense geographic aggregation with one identical haplotype strongly suggests a remote founder phenomenon for these Venezuelan acute intermittent porphyria families, carrying an unreported but most frequent HMBS mutation. PMID: 20978940
  14. Findings indicate that using TATA-binding protein (TBP) alone or in combination with hydroxymethylbilane synthase (HMBS) as endogenous controls could be a reliable method for normalizing qRT-PCR data in hepatoma cell lines treated with TNF-alpha. PMID: 23811755
  15. The novel mutations of HMBS gene were three missense (R26L, R173G and D178H), two frameshift (c.749_765dup and c.874insC) and one intronic deletion (IVS12+3_+11delAGGGCCTGT). PMID: 19656452
  16. The informative SNPs of HMBS gene reveal a distinctive haplotype which segregates with the R116W mutation present in the Dutch AIP families (-64T, 1345 G, 2479 G, 3581 G, 6479 T, 7064 C and 8578 A). PMID: 19656453
  17. One small deletion and six nucleotide substitutions within the 5'UTR and the housekeeping promoter of HMBS gene are found responsible for the non-erythroid form of acute intermittent porphyria. PMID: 22748422
  18. Two novel porphobilinogen deaminase mutations have been identified in acute intermittent porphyria patients with accompanying anemia in mainland China. PMID: 21669542
  19. We identified a monoallelic missense mutation p.Arg201Gly (c.601CNG)in HMBS gene in the patient with Lichen sclerosus et atrophicus-like skin lesions. PMID: 20580577
  20. Molecular genetic study of acute intermittent porphyria in Russia: mutation analysis and functional polymorphism search in porphobilinogen deaminase gene PMID: 20536026
  21. Acute intermittent porphyria: novel missense mutations in the human hydroxymethylbilane synthase gene PMID: 11399210
  22. In Italy, molecular analysis of the HMBS gene in acute intermittent porphyria patients and in family members of Italian ancestry identified 13 different mutations among 14 patients; 7 are new findings. PMID: 11831862
  23. 40% of all mutations identified among the Polish acute intermittent porphyria (AIP)patients in this study are novel, indicating the heterogeneity of molecular defects causing AIP. PMID: 11857754
  24. A novel mutation of the PBGD gene has been identified in a patient with acute intermittent porphyria presenting with severe and bilateral axonal radial motor neuropathy. PMID: 11940707
  25. A mutation that results in an inactive holo-protein that exists as a complex with two substrate molecules covalently bound to the dipyrromethane cofactor arising from the reaction between the apo-protein and pre-uroporphyrinogen PMID: 12773194
  26. Modulation of penetrance by the wild-type allele in dominantly inherited erythrohepatic and acute hepatic porphyrias was studied using HMBS. PMID: 14669009
  27. screening of the DNA of 20 unrelated individuals revealed 20 different mutations, 11 of which had not been reported previously; the novel mutations affected intron 1, exon 5, intron 6, intron 7, intron 9, intron 13 , exon 15. PMID: 15003823
  28. recurrent mutations G111R and R173Q occur at CpG motifs in the porphobilinogen deaminase gene in acute intermittent porphyria patients PMID: 15669678
  29. Three novel mutations within the HMBS gene are associated with acute intermittent porphyria. PMID: 16211556
  30. Sequencing of the hydroxymethylbilane synthase and uroporphyrinogen decarboxylase genes confirmed the relatively rare diagnosis of dual porphyria, and revealed a novel uroporphyrinogen decarboxylase mutation PMID: 16390615
  31. the R173W mutation may have a role in acute intermittent porphyria PMID: 16817012
  32. We demonstrate that the PBGD cellular pool is controlled by the proteasome activity, which in turn is down regulated by hemin or up-regulated by Pb-ALAD. PMID: 16935474
  33. the search for mutations identified among Slavic acute intermittent porphyria patients 65 such mutations were found and concluded that there is not a distinct predominance of certain mutations in Slavs PMID: 17298216
  34. Identification of a nonsense mutation in the porphobilinogen deaminase gene on chromosome 11q23.3, which harbors the mutations causing acute intermittent porphyria, as the underlying genetic defect in Chester porphyria. PMID: 17298217
  35. The motor neuropathy showed a steady and gradual improvement following the hematin treatment. Molecular analysis of the porphobilinogen deaminase gene revealed a short segment deletion. PMID: 17459418
  36. Molecular analyses of the PBGD gene revealed a novel mutation in exon 15, the 973insG. PMID: 18070416
  37. A mother and two children had a C insertion in exon 14 resulting in acute intermittent porphyria. PMID: 18405488
  38. Recombinant T59I and V215M had residual activity of 80.6% and 19.4%, respectively, of that of the wild type enzyme. PMID: 18406650
  39. 12-bp deletion mutation resulting in a 4-amino acid (AA) deletion from AA positions 337 to 340 found in patient and two family members PMID: 18554962
  40. Molecular analysis of twenty-four unrelated Chinese acute intermittent porphyria patients from Taiwan identified twenty-five HMBS mutations. There were 10 missense (40%), four nonsense (16%), five frame-shift (20%) and six splice site (24%) mutations. PMID: 18627369
  41. structure provides insights into the mechanism of action of PBGD at the molecular level and could aid the development of potential drugs for the up-regulation of PBGD activity in acute intermittent porphyria PMID: 18936296
  42. The decrease in the expression of ubiquitous HMBS and UROS mRNAs under hypoxia is associated with accumulation of hypoxia-inducible factor 1alpha protein. PMID: 19021769
  43. 6 mutations in exons common to housekeeping & erythroid-specific isoforms were evaluated at the structural level based on the 3-D structure of the E. coli enzyme. The new missense c.95G>C(p.R32P) is the 1st de novo mutation in the Israeli AIP population. PMID: 19138865
  44. structure of the human uPBGD (ubiquitous PBGD) mutant, R167Q, that has been determined by X-ray crystallography and refined to 2.8 A PMID: 19207107
  45. Molecular analyses of the hydroxymethylbilane synthase gene revealed seven mutations, in Acute intermittent porphyria PMID: 19292878

Show More

Hide All

Involvement in disease
Acute intermittent porphyria (AIP)
Subcellular Location
Cytoplasm.
Protein Families
HMBS family
Tissue Specificity
[Isoform 1]: Is ubiquitously expressed.; [Isoform 2]: Is found only in erythroid cells.
Database Links

HGNC: 4982

OMIM: 176000

KEGG: hsa:3145

STRING: 9606.ENSP00000278715

UniGene: Hs.82609

icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 7 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2026 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1
Place an order now

I. Product details

*
*
*
*

II. Contact details

*
*

III. Ship To

*
*
*
*
*
*
*

IV. Bill To

*
*
*
*
*
*
*
*