Please click here to enter our new website >> Cusabio
 
 

 

human ARF5 Expression-ready cDNA clone
Product Name human ARF5 Expression-ready cDNA clone
Synonyms
Catalog Number CSB-CL009011h
Relevance GTP-binding protein that functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. Involved in protein trafficking; may modulate vesicle budding and uncoating within the Golgi apparatus.
Length 540 bp
Accession NO. NM_001662
Vector PGEX-6P-1
Host TOP6
Form 4 ug plasmid, 2ml bacterial strain, glycerol stock
Storage Store at -20
Notes Repeated freezing and thawing is not recommended.
Application Expression of gene directly in E. coli and not need subclone.
Gene sequence GGCCTCACCGTGTCCGCGCTCTTTTCGCGGATCTTCGGGAAGAAGCAGATGCGGATTCTCATGGTTGGCT
TGGATGCGGCTGGCAAGACCACAATCCTGTACAAACTGAAGTTGGGGGAGATTGTCACCACCATCCCAAC
CATAGGCTTCAATGTAGAAACAGTGGAATATAAGAACATCTGTTTCACAGTCTGGGACGTGGGAGGCCAG
GACAAGATTCGGCCTCTGTGGCGGCACTACTTCCAGAACACTCAGGGCCTCATCTTTGTGGTGGACAGTA
ATGACCGGGAGCGGGTCCAAGAATCTGCTGATGAACTCCAGAAGATGCTGCAGGAGGACGAGCTGCGGGA
TGCAGTGCTGCTGGTATTTGCCAACAAGCAGGACATGCCCAACGCCATGCCCGTGAGCGAGCTGACTGAC
AAGCTGGGGCTACAGCACTTACGCAGCCGCACGTGGTATGTCCAGGCCACCTGTGCCACCCAAGGCACAG
GTCTGTACGATGGTCTGGACTGGCTGTCCCACGAGCTGTCAAAGCGCTAA
Referrences [1] "Molecular identification of ADP-ribosylation factor mRNAs and their expression in mammalian cells."
Tsuchiya M., Price S.R., Tsai S.-C., Moss J., Vaughan M.
J. Biol. Chem. 266:2772-2777(1991) [PubMed: 1993656] [Abstract]
Cited for: NUCLEOTIDE SEQUENCE [MRNA].

[2] "Localization and characterization of the human ADP-ribosylation factor 5 (ARF5) gene."
McGuire R.E., Daiger S.P., Green E.D.
Genomics 41:481-484(1997) [PubMed: 9169151] [Abstract]
Cited for: NUCLEOTIDE SEQUENCE [GENOMIC DNA / MRNA].

 

ELISA Kit
Other Kit

 

Native Protein
Recombinant Protein
In Stock
Order now, ship in 6 weeks

 

Immune Serum

 

Primary Antibodies
Monoclonal Antibodies
Polyclonal Antibodies
Secondary Antibodies

 

 

RT-PCR Primer
Clone

 

 

Diagnostic Antigen
Diagnostic Antibody

 

 

Home    |    About Us    |    Products    |    Technical Support    |    Distributor    |    Contact Us    |    Privacy Statement

Copyright © 2010 www.cusabio.com All Rights Reserved.