Please click here to enter our new website >> Cusabio
 
 

 

human ARHA Expression-ready cDNA clone
Product Name human ARHA Expression-ready cDNA clone
Synonyms
Catalog Number CSB-CL008711h
Relevance Regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. Serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders. May be an activator of PLCE1. Activated by ARHGEF2, which promotes the exchange of GDP for GTP. Essential for the SPATA13-mediated regulation of cell migration and adhesion assembly and disassembly.
Length 573 bp
Accession NO. NM_001664
Vector PGEX-6P-1
Host TOP6
Form 4 ug plasmid, 2ml bacterial strain, glycerol stock
Storage Store at -20
Notes Repeated freezing and thawing is not recommended.
Application Expression of gene directly in E. coli and not need subclone.
Gene sequence ATGGCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCTCATAG
TCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAGAACTATGTGGCAGATATCGA
GGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCCTGAGG
CCCCTCTCCTACCCAGATACCGATGTTATACTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAA
ACATCCCAGAAAAGTGGACCCCAGAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAA
TAAGAAGGATCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAA
CCTGAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAGACCA
AAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAAGCTAGACGTGGGAAGAAAAA
ATCTGGGTGCCTT
Referrences [1] "Nucleotide sequence of human rho cDNA clone 12."
Yeramian P., Chardin P., Madaule P., Tavitian A.
Nucleic Acids Res. 15:1869-1869(1987) [PubMed: 3822842] [Abstract]
Cited for: NUCLEOTIDE SEQUENCE [MRNA].

[2] "Sequence of rho small GTP-binding protein cDNAs from human retina and identification of novel 5' end cloning artifacts."
Fagan K.P., Oliveira L., Pittler S.J.
Exp. Eye Res. 59:235-237(1994) [PubMed: 7835413] [Abstract]
Cited for: NUCLEOTIDE SEQUENCE [MRNA].
Tissue: Retina.

 

ELISA Kit
Other Kit

 

Native Protein
Recombinant Protein
In Stock
Order now, ship in 6 weeks

 

Immune Serum

 

Primary Antibodies
Monoclonal Antibodies
Polyclonal Antibodies
Secondary Antibodies

 

 

RT-PCR Primer
Clone

 

 

Diagnostic Antigen
Diagnostic Antibody

 

 

Home    |    About Us    |    Products    |    Technical Support    |    Distributor    |    Contact Us    |    Privacy Statement

Copyright © 2010 www.cusabio.com All Rights Reserved.