Please click here to enter our new website >> Cusabio
 
 

 

human ODC1 Expression-ready cDNA clone
Product Name human ODC1 Expression-ready cDNA clone
Synonyms
Catalog Number CSB-CL005311h
Relevance
Length 1386 bp
Accession NO. NM_002539
Vector PGEX-6P-1
Host TOP6
Form 4 ug plasmid, 2ml bacterial strain, glycerol stock
Storage Store at -20
Notes Repeated freezing and thawing is not recommended.
Application Expression of gene directly in E. coli and not need subclone.
Gene sequence ATGAACAACTTTGGTAATGAAGAGTTTGACTGCCACTTCCTCGATGAAGGTTTTACTGCCAAGGACATTC
TGGACCAGAAAATTAATGAAGTTTCTTCTTCTGATGATAAGGATGCCTTCTATGTGGCAGACCTGGGAGA
CATTCTAAAGAAACATCTGAGGTGGTTAAAAGCTCTCCCTCGTGTCACCCCCTTTTATGCAGTCAAATGT
AATGATAGCAAAGCCATCGTGAAGACCCTTGCTGCTACCGGGACAGGATTTGACTGTGCTAGCAAGACTG
AAATACAGTTGGTGCAGAGTCTGGGGGTGCCTCCAGAGAGGATTATCTATGCAAATCCTTGTAAACAAGT
ATCTCAAATTAAGTATGCTGCTAATAATGGAGTCCAGATGATGACTTTTGATAGTGAAGTTGAGTTGATG
AAAGTTGCCAGAGCACATCCCAAAGCAAAGTTGGTTTTGCGGATTGCCACTGATGATTCCAAAGCAGTCT
GTCGTCTCAGTGTGAAATTCGGTGCCACGCTCAGAACCAGCAGGCTCCTTTTGGAACGGGCGAAAGAGCT
AAATATCGATGTTGTTGGTGTCAGCTTCCATGTAGGAAGCGGCTGTACCGATCCTGAGACCTTCGTGCAG
GCAATCTCTGATGCCCGCTGTGTTTTTGACATGGGGGCTGAGGTTGGTTTCAGCATGTATCTGCTTGATA
TTGGCGGTGGCTTTCCTGGATCTGAGGATGTGAAACTTAAATTTGAAGAGATCACCGGCGTAATCAACCC
AGCGTTGGACAAATACTTTCCGTCAGACTCTGGAGTGAGAATCATAGCTGAGCCCGGCAGATACTATGTT
GCATCAGCTTTCACGCTTGCAGTTAATATCATTGCCAAGAAAATTGTATTAAAGGAACAGACGGGCTCTG
ATGACGAAGATGAGTCGAGTGAGCAGACCTTTATGTATTATGTGAATGATGGCGTCTATGGATCATTTAA
TTGCATACTCTATGACCACGCACATGTAAAGCCCCTTCTGCAAAAGAGACCTAAACCAGATGAGAAGTAT
TATTCATCCAGCATATGGGGACCAACATGTGATGGCCTCGATCGGATTGTTGAGCGCTGTGACCTGCCTG
AAATGCATGTGGGTGATTGGATGCTCTTTGAAAACATGGGCGCTTACACTGTTGCTGCTGCCTCTACGTT
CAATGGCTTCCAGAGGCCGACGATCTACTATGTGATGTCAGGGCCTGCGTGGCAACTCATGCAGCAATTC
CAGAACCCCGACTTCCCACCCGAAGTAGAGGAACAGGATGCCAGCACCCTGCCTGTGTCTTGTGCCTGGG
AGAGTGGGATGAAACGCCACAGAGCAGCCTGTGCTTCGGCTAGTATTAATGTGTAG
Referrences "Complete amino acid sequence of human ornithine decarboxylase deduced from complementary DNA."
Hickok N.J., Seppaenen P.J., Gunsalus G.L., Jaenne O.A.
DNA 6:179-187(1987) [PubMed: 3595418] [Abstract]
Cited for: NUCLEOTIDE SEQUENCE [MRNA].

[2] Jaenne O.A.
Submitted (APR-2003) to the EMBL/GenBank/DDBJ databases
Cited for: SEQUENCE REVISION TO 415.

 

ELISA Kit
Other Kit

 

Native Protein
Recombinant Protein
In Stock
Order now, ship in 6 weeks

 

Immune Serum

 

Primary Antibodies
Monoclonal Antibodies
Polyclonal Antibodies
Secondary Antibodies

 

 

RT-PCR Primer
Clone

 

 

Diagnostic Antigen
Diagnostic Antibody

 

 

Home    |    About Us    |    Products    |    Technical Support    |    Distributor    |    Contact Us    |    Privacy Statement

Copyright © 2010 www.cusabio.com All Rights Reserved.