A1CF

Code CSB-CL001002HU1
Size 10 μg plasmid + 200μl Glycerol
Uniprot No. Q9NQ94
Relevance Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 4, mRNA.
Alias ACF; ACF64; ACF65; APOBEC1CF; ASP; RP11-564C4.2
Immunogen Species Homo sapiens (Human)
Vector pUC
Sequence atggaatca aatcacaaatccggggatgg attgagcggc actcagaagg aagcagccct ccgcgcactg gtccagcgcacaggatatag cttggtccag gaaaatggac aaagaaaata tggtggccct ccacctggttgggatgctgc accccctgaa aggggctgtg aaatttttat tggaaaactt ccccgagacctttttgagga tgagcttata ccattatgtg aaaaaatcgg taaaatttat gaaatgagaatgatgatgga ttttaatggc aacaatagag gatatgcatt tgtaacattt tcaaataaagtggaagccaa gaatgcaatc aagcaactta ataattatga aattagaaat gggcgcctcttaggggtttg tgccagtgtg gacaactgcc gattatttgt tgggggcatc ccaaaaaccaaaaagagaga agaaatctta tcggagatga aaaaggttac tgaaggtgtt gtcgatgtcatcgtctaccc aagcgctgca gataaaacca aaaaccgagg ctttgccttc gtggagtatgagagtcatcg agcagctgcc atggcgagga ggaaactgct accaggaaga attcagttatggggacatgg tattgcagta gactgggcag agccagaagt agaagttgat gaagatacaatgtcttcagt gaaaatccta tatgtaagaa atcttatgct gtctacctct gaagagatgattgaaaagga attcaacaat atcaaaccag gtgctgtgga gagggtgaag aaaattcgagactatgcttt tgtgcacttc agtaaccgag aagatgcagt tgaggctatg aaagctttaaatggcaaggt gctggatggt tcccccattg aagtcaccct agcaaaacca gtggacaaggacagttatgt taggtatacc cgaggcacag gtggaagggg caccatgctg caaggagagtatacctactc tttgggccaa gtttatgatc ccaccacaac ctaccttgga gctcctgtcttctatgcccc ccagacctat gcagcaattc ccagtcttca tttcccagcc accaaaggacatctcagcaa cagagccatt atccgagccc cttctgttag aggggctgcg ggagtgagaggactgggcgg ccgtggctat ttggcataca caggcctggg tcgaggatac caggtcaaaggagacaaaag agaagacaaa ctctatgaca ttttacctgg gatggagctc accccaatgaatcctgtcac attaaaaccc caaggaatta aactcgctcc ccagatatta gaagagatttgtcagaaaaa taactgggga cagccagtgt accagctgca ctctgctatt ggacaagaccaaagacagct attcttgtac aaaataacta ttcctgctct agccagccag aatcctgcaatccacccttt cacacctcca aagctgagtg cctttgtgga tgaagcaaag acgtatgcagccgaatacac cctgcagacc ctgggcatcc ccactgatgg aggcgatggc accatggctactgctgctgc tgctgctact gctttcccag gatatgctgt ccctaatgca actgcacccgtgtctgcagc ccagctcaag caagcggtaa cccttggaca agacttagca gcatatacaacctatgaggt ctacccaact tttgcagtga ctgcccgagg ggatggatat ggcaccttctga
Target Names A1CF
Accession NO. NM_001198818.1
Target Details Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Alternative splicing occurs at this locus and three full-length transcript variants, encoding three distinct isoforms, have been described. Additional splicing has been observed but the full-length nature of these variants has not been determined.
HGNC 24086
RGD 619834
MGI 1917115
Still Have Questions? Leave a Message or Start an on-line Chat
Function Essential component of the apolipoprotein B mRNA editing enzyme complex which is responsible for the postranscriptional editing of a CAA codon for Gln to a UAA codon for stop in APOB mRNA. Binds to APOB mRNA and is probably responsible for docking the catalytic subunit, APOBEC1, to the mRNA to allow it to deaminate its target cytosine. The complex also protects the edited APOB mRNA from nonsense-mediated decay.
Subcellular Location Nucleus. Endoplasmic reticulum. Cytoplasm.
Tissue Specificity Widely expressed with highest levels in brain, liver, pancreas, colon and spleen.
Database Links

HGNC: 24086

KEGG: hsa:29974

STRING: 9606.ENSP00000282641

UniGene: Hs.282795

Related Products

A1CF Proteins

A1CF Proteins for Homo sapiens (Human)

icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 7 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2026 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1