Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
Code | CSB-CL001002HU1 |
Size | 10 μg plasmid + 200μl Glycerol |
Uniprot No. | Q9NQ94 |
Relevance | Homo sapiens APOBEC1 complementation factor (A1CF), transcript variant 4, mRNA. |
Alias | ACF; ACF64; ACF65; APOBEC1CF; ASP; RP11-564C4.2 |
Immunogen Species | Homo sapiens (Human) |
Vector | pUC |
Sequence | atggaatca aatcacaaatccggggatgg attgagcggc actcagaagg aagcagccct ccgcgcactg gtccagcgcacaggatatag cttggtccag gaaaatggac aaagaaaata tggtggccct ccacctggttgggatgctgc accccctgaa aggggctgtg aaatttttat tggaaaactt ccccgagacctttttgagga tgagcttata ccattatgtg aaaaaatcgg taaaatttat gaaatgagaatgatgatgga ttttaatggc aacaatagag gatatgcatt tgtaacattt tcaaataaagtggaagccaa gaatgcaatc aagcaactta ataattatga aattagaaat gggcgcctcttaggggtttg tgccagtgtg gacaactgcc gattatttgt tgggggcatc ccaaaaaccaaaaagagaga agaaatctta tcggagatga aaaaggttac tgaaggtgtt gtcgatgtcatcgtctaccc aagcgctgca gataaaacca aaaaccgagg ctttgccttc gtggagtatgagagtcatcg agcagctgcc atggcgagga ggaaactgct accaggaaga attcagttatggggacatgg tattgcagta gactgggcag agccagaagt agaagttgat gaagatacaatgtcttcagt gaaaatccta tatgtaagaa atcttatgct gtctacctct gaagagatgattgaaaagga attcaacaat atcaaaccag gtgctgtgga gagggtgaag aaaattcgagactatgcttt tgtgcacttc agtaaccgag aagatgcagt tgaggctatg aaagctttaaatggcaaggt gctggatggt tcccccattg aagtcaccct agcaaaacca gtggacaaggacagttatgt taggtatacc cgaggcacag gtggaagggg caccatgctg caaggagagtatacctactc tttgggccaa gtttatgatc ccaccacaac ctaccttgga gctcctgtcttctatgcccc ccagacctat gcagcaattc ccagtcttca tttcccagcc accaaaggacatctcagcaa cagagccatt atccgagccc cttctgttag aggggctgcg ggagtgagaggactgggcgg ccgtggctat ttggcataca caggcctggg tcgaggatac caggtcaaaggagacaaaag agaagacaaa ctctatgaca ttttacctgg gatggagctc accccaatgaatcctgtcac attaaaaccc caaggaatta aactcgctcc ccagatatta gaagagatttgtcagaaaaa taactgggga cagccagtgt accagctgca ctctgctatt ggacaagaccaaagacagct attcttgtac aaaataacta ttcctgctct agccagccag aatcctgcaatccacccttt cacacctcca aagctgagtg cctttgtgga tgaagcaaag acgtatgcagccgaatacac cctgcagacc ctgggcatcc ccactgatgg aggcgatggc accatggctactgctgctgc tgctgctact gctttcccag gatatgctgt ccctaatgca actgcacccgtgtctgcagc ccagctcaag caagcggtaa cccttggaca agacttagca gcatatacaacctatgaggt ctacccaact tttgcagtga ctgcccgagg ggatggatat ggcaccttctga |
Target Names | A1CF |
Accession NO. | NM_001198818.1 |
Target Details | Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Alternative splicing occurs at this locus and three full-length transcript variants, encoding three distinct isoforms, have been described. Additional splicing has been observed but the full-length nature of these variants has not been determined. |
HGNC | 24086 |
RGD | 619834 |
MGI | 1917115 |
Still Have Questions? | Leave a Message or Start an on-line Chat |
Function | Essential component of the apolipoprotein B mRNA editing enzyme complex which is responsible for the postranscriptional editing of a CAA codon for Gln to a UAA codon for stop in APOB mRNA. Binds to APOB mRNA and is probably responsible for docking the catalytic subunit, APOBEC1, to the mRNA to allow it to deaminate its target cytosine. The complex also protects the edited APOB mRNA from nonsense-mediated decay. |
Subcellular Location | Nucleus. Endoplasmic reticulum. Cytoplasm. |
Tissue Specificity | Widely expressed with highest levels in brain, liver, pancreas, colon and spleen. |
Database Links |
HGNC: 24086 KEGG: hsa:29974 STRING: 9606.ENSP00000282641 UniGene: Hs.282795 |
A1CF Proteins for Homo sapiens (Human)
Code | Product Name | Source |
---|---|---|
CSB-YP001002HU CSB-EP001002HU CSB-BP001002HU CSB-MP001002HU CSB-EP001002HU-B |
Recombinant Human APOBEC1 complementation factor (A1CF) | Yeast E.coli Baculovirus Mammalian cell In Vivo Biotinylation in E.coli |