ABCD3

Code CSB-CL001074HU1
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens ATP-binding cassette, sub-family D (ALD), member 3, mRNA
Alias ABC43;PMP70;PXMP1
Vector pENTR223.1
Sequence atggcggccttcagcaagtacttgacggcgcgaaactcctcgctggctggtgccgcgttcctgctgctctgcctgctccacaagcggcgccgcgccctcggcctgcacggtaagaaaagtggaaaaccaccattacagaacaatgagaaagaggggaaaaaggagcgagctgtggtggacaaggtgtttttctcaaggctcatacagattctgaaaatcatggtccctagaacattttgtaaagagacaggttacttggtacttattgctgttatgctggtgtctcgaacatattgtgatgtttggatgattcaaaatgggacactaattgaaagtggtatcattggtcgtagcaggaaagatttcaagagatacttactcaacttcatcgctgccatgcctcttatctctctggttaataacttcttgaagtatgggttaaatgagcttaaactgtgcttccgagtaaggctcactaaatacctctatgaggagtatcttcaagctttcacatattataaaatggggaatctggacaacagaatagctaatccagaccagctgcttacacaagatgtagaaaaattttgtaacagtgtagtcgatctgtattcaaatcttagtaagccatttttagacatagttttgtatatctttaagttaacgagtgcaattggagctcaggtacttggaaaaattttgtggcattaa
Accession NO. BC009712
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers

Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
Address
7505 Fannin St. Ste 610-312, Houston, TX 77054, USA
Join Us with

Subscribe newsletter

Leave a message

© 2007-2022 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1