Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
| Code | CSB-CL001955HU1 |
| Size | 10 μg plasmid + 200μl Glycerol |
| Relevance | Homo sapiens aprataxin, mRNA (cDNA clone IMAGE:3538192), complete cds |
| Alias | AOA;AOA1;EAOH;EOAHA;FHA-HIT;FLJ20157;MGC1072 |
| Vector | pENTR223.1 |
| Sequence | atgcaggaccccaaaatgcaggtttacaaagatgagcaggtggtggtgataaaggataaatacccaaaggcccgttaccattggctggtcttaccgtggacctccatttccagtctgaaggctgtggccagggaacaccttgaactccttaagcatatgcacactgtgggggaaaaggtgattgtagattttgctgggtccagcaaactccgcttccgattgggctaccacgccattccgagtatgagccatgtacatcttcatgtgatcagccaggattttgattctccttgccttaaaaacaaaaaacattggaattctttcaatacagaatacttcctagaatcacaagctgtgatcgagatggtacaagaggctggtagagtaactgtccgagatgggatgcctgagctcttgaagctgccccttcgttgtcatgagtgccagcagctgctgccttccattcctcagctgaaagaacatctcaggaagcactggacacagtga |
| Accession NO. | BC001628 |
| Still Have Questions? | Leave a Message or Start an on-line Chat |
Recombinant Human interleukin-16 protein(IL16) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-17B protein(IL17B) (Active)
Express system: E.Coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-1 beta protein(IL1B) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-1 receptor antagonist protein(IL1RN) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-4 protein(IL4) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-5 protein(IL5) (Active)
Express system: E.Coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-9 protein(IL9) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-10 protein(IL10) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
