CD38

Code CSB-CL004929HU
Size 10 μg plasmid + 200μl Glycerol
Vector pENTR223.1
Sequence atggccaactgcgagttcagcccggtgtccggggacaaaccctgctgccggctctctaggagagcccaactctgtcttggcgtcagtatcctggtcctgatcctcgtcgtggtgctcgcggtggtcgtcccgaggtggcgccagcagtggagcggtccgggcaccaccaagcgctttcccgagaccgtcctggcgcgatgcgtcaagtacactgaaattcatcctgagatgagacatgtagactgccaaagtgtatgggatgctttcaagggtgcatttatttcaaaacatccttgcaacattactgaagaagactatcagccactaatgaagttgggaactcagaccgtaccttgcaacaagattcttctttggagcagaataaaagatctggcccatcagttcacacaggtccagcgggacatgttcaccctggaggacacgctgctaggctaccttgctgatgacctcacatggtgtggtgaattcaacacttccaaaataaactatcaatcttgcccagactggagaaaggactgcagcaacaaccctgtttcagtattctggaaaacggtttcccgcaggtttgcagaagctgcctgtgatgtggtccatgtgatgctcaatggatcccgcagtaaaatctttgacaaaaacagcacttttgggagtgtggaagtccataatttgcaaccagagaaggttcagacactagaggcctgggtgatacatggtggaagagaagattccagagacttatgccaggatcccaccataaaagagctggaatcgattataagcaaaaggaatattcaattttcctgcaagaatatctacagacctgacaagtttcttcagtgtgtgaaaaatcctgaggattcatcttgcacatctgagatctga
Accession NO. BC007964
Still Have Questions? Leave a Message or Start an on-line Chat

Q&A and Customer Reviews

Q&A
Q:

Regarding your cDNA product CSB-CL004929HU, could you please advise on if this is this the cDNA for the soluble form or for the whole CD38 protein?

A:
Very nice to receive your inquiry.
CSB-CL004929HU CD38 BC007964 903 bp pENTR223.1 or PUC Vector
This clone corresponds to the full length of CD38 protein. But whether it will express in soluble form or not, this depends on the expression of the protein.
If we express this protein, we will guarantee to provide is in soluble, all of our proteins are provided in soluble form.

icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 7 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2026 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1