All
  • All
  • ELISA Kit
  • Protein
  • Antibody
  • Molecular Biology Product
  • Small Molecule
All
  • All
  • ELISA Kit
  • Protein
  • Antibody
  • Molecular Biology Product
  • Small Molecule

CD38

Code CSB-CL004929HU
Size 10 μg plasmid + 200μl Glycerol
Vector pENTR223.1
Sequence atggccaactgcgagttcagcccggtgtccggggacaaaccctgctgccggctctctaggagagcccaactctgtcttggcgtcagtatcctggtcctgatcctcgtcgtggtgctcgcggtggtcgtcccgaggtggcgccagcagtggagcggtccgggcaccaccaagcgctttcccgagaccgtcctggcgcgatgcgtcaagtacactgaaattcatcctgagatgagacatgtagactgccaaagtgtatgggatgctttcaagggtgcatttatttcaaaacatccttgcaacattactgaagaagactatcagccactaatgaagttgggaactcagaccgtaccttgcaacaagattcttctttggagcagaataaaagatctggcccatcagttcacacaggtccagcgggacatgttcaccctggaggacacgctgctaggctaccttgctgatgacctcacatggtgtggtgaattcaacacttccaaaataaactatcaatcttgcccagactggagaaaggactgcagcaacaaccctgtttcagtattctggaaaacggtttcccgcaggtttgcagaagctgcctgtgatgtggtccatgtgatgctcaatggatcccgcagtaaaatctttgacaaaaacagcacttttgggagtgtggaagtccataatttgcaaccagagaaggttcagacactagaggcctgggtgatacatggtggaagagaagattccagagacttatgccaggatcccaccataaaagagctggaatcgattataagcaaaaggaatattcaattttcctgcaagaatatctacagacctgacaagtttcttcagtgtgtgaaaaatcctgaggattcatcttgcacatctgagatctga
Accession NO. BC007964
Still Have Questions? Leave a Message or Start an on-line Chat

Q&A and Customer Reviews

Q&A
Q:

Regarding your cDNA product CSB-CL004929HU, could you please advise on if this is this the cDNA for the soluble form or for the whole CD38 protein?

A:
Very nice to receive your inquiry.
CSB-CL004929HU CD38 BC007964 903 bp pENTR223.1 or PUC Vector
This clone corresponds to the full length of CD38 protein. But whether it will express in soluble form or not, this depends on the expression of the protein.
If we express this protein, we will guarantee to provide is in soluble, all of our proteins are provided in soluble form.
Read More
Hide All

Product Center

Kit

Protein

Antibody

Stable Cell Line

Small Molecule

Promotions
Buy 2+ Cytokine ELISA Kits & Get 20% OFF!
Obtain Rewards by Referring A Friend
Reward For Reviews
Transmembrane Protein Questionnaire with Gifts
icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of email
Email
[email protected]
icon of address
Address
7505 Fannin St., Ste 610, Room 7 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2024 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1
Privacy Policy