Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
| Code | CSB-CL005936HU |
| Size | 10 μg plasmid + 200μl Glycerol |
| Relevance | Homo sapiens cellular retinoic acid binding protein 2, mRNA (cDNA clone MGC:1183 IMAGE:2988143), complete cds |
| Alias | CRABP-II;RBP6 |
| Vector | pENTR223.1 |
| Sequence | atgcccaacttctctggcaactggaaaatcatccgatcggaaaacttcgaggaattgctcaaagtgctgggggtgaatgtgatgctgaggaagattgctgtggctgcagcgtccaagccagcagtggagatcaaacaggagggagacactttctacatcaaaacctccaccaccgtgcgcaccacagagattaacttcaaggttggggaggagtttgaggagcagactgtggatgggaggccctgtaagagcctggtgaaatgggagagtgagaataaaatggtctgtgagcagaagctcctgaagggagagggccccaagacctcgtggaccagagaactgaccaacgatggggaactgatcctgaccatgacggcggatgacgttgtgtgcaccagggtctacgtccgagagtga |
| Accession NO. | BC001109 |
| Still Have Questions? | Leave a Message or Start an on-line Chat |
Recombinant Human Interleukin-15 protein(IL15) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human interleukin-16 protein(IL16) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human interleukin-16 proein(IL16) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-17B protein(IL17B) (Active)
Express system: E.Coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-1 beta protein(IL1B) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-2 protein(IL2) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-3 protein(IL3) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-5 protein(IL5) (Active)
Express system: E.Coli
Species: Homo sapiens (Human)
