Code CSB-CL006101HU
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens cystatin-like 1, mRNA (cDNA clone MGC:151005 IMAGE:40125947), complete cds
Alias dJ322G13.4;RCET11
Vector pENTR223.1
Sequence atggggatcggatgctggagaaaccccctgctgctgctgattgccctggtcctgtcagccaagctgggtcacttccaaaggtgggagggcttccagcagaagctcatgagcaagaagaacatgaattcaacactcaacttcttcattcaatcctacaacaatgccagcaacgacacctacttatatcgagtccagaggctaattcgaagtcagatgcagctgacgacgggagtggagtatatagtcactgtgaagattggccggaccaaatgcaagaggaatgacacgagcaattcttcctgccccctgcaaagcaagaagctgagaaagagtttaatttgcgagtctttgatatacaccatgccctggataaactatttccagctctggaacaattcctgtctggaggccgagcatgtgggcagaaacctcagatga
Accession NO. BC117396
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers


Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

© 2007-2022 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1