GLDN

Code CSB-CL009495HU
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens gliomedin, mRNA (cDNA clone MGC:141957 IMAGE:8322449), complete cds
Alias CLOM;CRG-L2;UNC-112
Vector pUC
Sequence ATGGTGGACCTGTGCAACAGCACCAAGGGCATCTGCCTCACAGGACCTTCTGGACCACCAGGACCTCCGGGAGCCGGCGGGTTGCCAGGACACAACGGATTGGATGGACAGCCTGGTCCTCAGGGCCCAAAAGGAGAAAAAGGAGCAAATGGAAAAAGAGGAAAAATGGGGATACCTGGAGCTGCAGGAAATCCAGGGGAAAGGGGAGAAAAGGGAGACCATGGTGAACTGGGCCTGCAGGGAAATGAGGGCCCACCAGGGCAGAAGGGAGAAAAGGGTGACAAAGGAGATGTGTCCAACGACGTGCTCCTGGCAGGTGCCAAAGGTGACCAAGGCCCACCCGGTCCACCTGGGCCCCCAGGCCCTCCAGGTCCTCCAGGGCCCCCTGGAAGCAGAAGAGCCAAAGGCCCTCGGCAGCCAAACATGTTCAACGGCCAGTGCCCAGGTGAGACTTGTGCCATACCAAATGATGATACCTTGGTTGGAAAAGCTGATGAGAAAGCCAGTGAACACCATTCCCCACAAGCAGAATCCATGATCACTTCCATTGGAAACCCAGTGCAAGTACTGAAAGTGACAGAGACATTTGGGACTTGGATAAGAGAGTCTGCTAACAAGAGTGATGACCGGATTTGGGTGACAGAGCATTTTTCAGGCATCATGGTTAAGGAATTCAAGGATCAGCCCTCACTTCTGAATGGCAGTTACACGTTCATCCACCTTCCATACTATTTCCATGGCTGTGGGCACGTTGTTTACAACAACTCTCTCTACTACCACAAAGGGGGTTCTAATACCCTAGTGAGATTTGAATTTGGCCAGGAAACATCCCAAACTCTGAAGCTTGAAAATGCCTTGTATTTTGATCGAAAATACCTTTTTGCAAATTCCAAAACTTACTTCAATCTAGCTGTAGATGAAAAGGGCCTTTGGATTATCTATGCGTCAAGTGTGGACGGCTCGAGCATTCTTGTAGCACAACTGGATGAGAGGACATTCTCAGTGGTGCAACACGTCAATACCACGTACCCTAAATCCAAGGCTGGCAACGCCTTCATTGCCCGAGGAATCCTCTATGTCACAGACACCAAAGATATGAGGGTCACATTTGCCTTTGATTTGTTAGGAGGGAAACAGATCAATGCAAACTTTGATTTAAGAACTTCCCAGTCTGTTCTTGCCATGTTAGCATACAACATGAGAGATCAGCATTTATATTCATGGGAAGATGGCCATTTAATGCTTTATCCTGTGCAGTTTTTGTCAACTACCTTAAATCAGTGA
Accession NO. BC113397
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2018 www.cusabio.com CUSABIO TECHNOLOGY LLC All Rights Reserved.

Wait!

Join the 25,000 subscribers to get research hotpots, technical tips, latest information on events, sales and offers.

Sign up now!

We don't deal in spam.