HTR5A

Code CSB-CL010896HU
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens 5-hydroxytryptamine (serotonin) receptor 5A, mRNA (cDNA clone MGC:142028 IMAGE:8322520), complete cds
Alias 5-HT5A
Vector pENTR223.1
Sequence ATGGATTTACCAGTGAACCTAACCTCCTTTTCCCTCTCCACCTCCTCCCCTTTGGAGACCAACCACAGCCTCGGCAAAGACGACCTGCGCCCCAGCTCGCCCCTGCTCTCGGTCTTCGGAGTGCTTATTCTCACCTTGCTGGGCTTTCTGGTGGCGGCGACGTTCGCCTGGAACCTGCTGGTGCTGGCGACCATCCTCCGTGTACGCACCTTCCACCGCGTGCCCCACAACCTGGTGGCATCCATGGCCGTCTCGGATGTCCTGGTGGCCGCGCTGGTCATGCCGCTGAGCCTGGTGCACGAGCTGTCCGGGCGCCGCTGGCAGCTAGGTCGGAGGCTGTGCCAGCTTTGGATCGCGTGCGACGTGCTTTGCTGCACGGCCAGCATCTGGAACGTGACGGCCATAGCCCTGGACCGCTACTGGTCCATCACGCGCCACATGGAATACACGCTCCGCACCCGCAAGTGCGTCTCCAACGTCATGATCGCGCTCACCTGGGCACTCTCCGCTGTCATCTCTCTGGCCCCGCTGCTTTTTGGCTGGGGAGAGACGTACTCTGAGGGCAGCGAGGAGTGCCAGGTAAGCCGCGAGCCTTCCTACGCCGTGTTCTCCACCGTAGGCGCCTTCTACCTGCCGCTCTGTGTGGTGCTCTTCGTGTACTGGAAGATCTACAAGGCTGCCAAGTTCCGCGTGGGCTCCAGGAAGACCAATAGCGTCTCACCCATATCCGAAGCTGTGGAGGTGAAGGACTCTGCCAAACAGCCCCAGATGGTGTTCACGGTCCGCCACGCCACCGTCACCTTCCAGCCAGAAGGGGACACGTGGCGGGAGCAGAAGGAGCAGCGGGCCGCCCTCATGGTGGGCATCCTCATTGGCGTGTTCGTGCTCTGCTGGATCCCCTTCTTTCTCACCGAGCTCATCAGTCCCCTCTGCTCCTGTGACATCCCCGCCATCTGGAAAAGCATCTTCCTGTGGCTTGGCTACTCCAACTCCTTCTTTAACCCCCTGATCTATACGGCTTTCAACAAGAACTACAACAGCGCCTTCAAGAACTTCTTTTCTAGGCAACACTGA
Accession NO. BC113468
Still Have Questions? Leave a Message or Start an on-line Chat
icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 322 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2024 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1