IFNA4

Code CSB-CL011040HU2
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens interferon, alpha 4, mRNA (cDNA clone MGC:142202 IMAGE:8322694), complete cds
Alias INFA4
Vector pENTR223.1
Sequence atggccctgtccttttctttactgatggccgtgctggtgctcagctacaaatccatctgttctctgggctgtgatctgcctcagacccacagcctgggtaataggagggccttgatactcctggcacaaatgggaagaatctctcatttctcctgcctgaaggacagacatgatttcggattccccgaggaggagtttgatggccaccagttccagaaggctcaagccatctctgtcctccatgagatgatccagcagaccttcaatctcttcagcacagaggactcatctgctgcttgggaacagagcctcctagaaaaattttccactgaactttaccagcaactgaatgacctggaagcatgtgtgatacaggaggttggggtggaagagactcccctgatgaatgaggactccatcctggctgtgaggaaatacttccaaagaatcactctttatctaacagagaagaaatacagcccttgtgcctgggaggttgtcagagcagaaatcatgagatccctctcgttttcaacaaacttgcaaaaaagattaaggaggaaggattga
Accession NO. BC113642
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

© 2007-2022 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1