Code CSB-CL013214HU
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens lymphocyte-specific protein 1, mRNA (cDNA clone MGC:2290 IMAGE:3542307), complete cds
Alias pp52;WP34
Vector pENTR223.1
Sequence atggcggaggcttcgagtgacccgggtgctgaggagcgggaagagttgctggggcccactgctcagtggagcgtggaggacgaggaggaggccgtccacgagcaatgccagcatgagagagacaggcagcttcaggcccaggacgaggagggaggcggccatgtccccgagcggccgaagcaggagatgctcctcagcctgaagccctcggaggcccctgaactggatgaggacgagggctttggcgactggtcccagaggccagagcagcggcagcagcacgagggggcgcagggcaccttggacagcggagagcccccccagtgcaggagtcctgagggggagcaagaggacaggcccggcctgcatgcctacgaaaaggaggacagtgatgaagtccacctggaggagttgagtctgagcaaggaggggccaggcccagaggacactgtccaggacaacctgggggccgcaggggctgaggaggaacaggaggagcaccagaaatgtcagcagcccaggacacccagccccttggtcttggaggggaccatcgaacagagctcgcctcccctgagccctaccaccaaactcatcgacaggaccgagtccctaaaccgctccatagagaagagtaacagtgtgaagaaatcccagccagacttgcccatctccaagattgatcagtggctggaacaatacacccaggccatcgagaccgctggccggacccccaagctagcccgccaggcctccatagagctgcccagcatggctgtggccagtaccaagagtcggtgggagacgggtgaggtacaggctcagtctgcggccaagactccgtcctgcaaggatattgtggctggagacatgagcaagaaaagcctctgggagcagaagggaggctccaagacctcatcaacaattaagagcaccccatctgggaagaggtataagtttgtggccaccgggcatgggaagtatgagaaggtgcttgtggaagggggcccggctccctag
Accession NO. BC001785
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers

Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
7505 Fannin St Ste 610-322 Houston, TX 77054, USA
Join Us with

Leave a message

check code
© 2007-2023 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1