MRPS11

Code CSB-CL014879HU1
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens mitochondrial ribosomal protein S11, mRNA (cDNA clone MGC:22144 IMAGE:4452949), complete cds
Alias FLJ22512;FLJ23406;HCC-2
Vector pENTR223.1
Sequence atgcaggctgtgagaaacgcggggtcgcggttcctgcggtcctggacttggccccagacagccggggtcgtggccagaacgccggccgggaccatctgcacaggcgctcgacagctccaagacgctgcggccaagcagaaagttgaacagaacgcggctcccagccacaccaagttcagcatttaccctcccattccaggagaggagagctctctgaggtgggcaggaaagaaatttgaggagatcccaattgcacacattaaagcatcccacaacaacacacagatccaggtagtctctgctagtaatgagccccttgcctttgcttcctgtggcacagagggatttcggaatgccaagaagggcacaggcatcgcagcacagacagcaggcatagccgcagcggcgagagctaaacaaaagggcgtgatccacatccgagttgtggtgaaaggcctggggccaggacgcttgtctgccatgcacggactgatcatgggcggcctggaagtgatctcaatcacagacaacaccccaatcccacacaacggctgccgccccaggaaggctcggaagctgtga
Accession NO. BC012489
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

© 2007-2022 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1