Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
| Code | CSB-CL715122HU |
| Size | 10 μg plasmid + 200μl Glycerol |
| Vector | pENTR223.1 |
| Sequence | atggccgtcccagccaagaaaaggaagatgaacttctcagagcgggaggtggagatcatcgtggaggagctggagctgaagaagcacctgctggtgaaccacttcaacgccggggtacccctggccgccaagagtgcggcctggcacggcatcctgagaagggtcaacgccgtggccacctgccgcagagagctgcctgaggtcaagaagaagtggtctgacctcaagaccgaggtccgtcgcaaggttgcccaggtccgggccgccgtggagggtggtgaggcgccggggcccactgaggaggacggagctggggggcctgggacaggcggtggcagtggcggcggtggcccagctgtagccccagtgctgctgacccccatgcaacaacgtatctgcaacctgctgggcgaggccaccatcatcagcctgcccagcaccacagagatccaccctgtggccctcggaccctcggccaccgcagccgcagccacggtcaccctgacacagagtgagtga |
| Accession NO. | BC021580 |
| Still Have Questions? | Leave a Message or Start an on-line Chat |
Recombinant Human interleukin-16 proein(IL16) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-1 beta protein(IL1B) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-2 protein(IL2) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-3 protein(IL3) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-4 protein(IL4) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-5 protein(IL5) (Active)
Express system: E.Coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-10 protein(IL10) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
