SPIN3

Code CSB-CL708489HU
Size 10 μg plasmid + 200μl Glycerol
Vector pENTR223.1
Sequence atgaagaccccgtttggaaaggcagctgcagggcagcggtccaggacgggcgctggccacggcagtgtgtctgttaccatgataaagaggaaggctgcacacaagaagcataggagccgacccacctcccagcctcgggggaacatcgtgggctgcagaattcagcacggatggaaagatggagatgaacctctaacacagtggaaaggaaccgttctggatcagctcctttga
Accession NO. BC032490
Still Have Questions? Leave a Message or Start an on-line Chat
icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 7 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2025 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1