Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
Code | CSB-CL619959HU2 |
Size | 10 μg plasmid + 200μl Glycerol |
Uniprot No. | Q15025 |
Relevance | Homo sapiens TNFAIP3 interacting protein 1 (TNIP1), transcript variant 3, mRNA. |
Alias | ABIN-1; NAF1; nip40-1; VAN |
Immunogen Species | Homo sapiens (Human) |
Vector | pUC |
Sequence | at ggaagcgaccaggctccggc agaaggcaga ggagctagtg aaggacaacg agctgctccc accaccttctccctccttgg gctccttcga ccccctggct gagctcacag gaaaggactc aaatgtcacagcatctccca cagcccctgc atgccccagt gacaagccag caccagtcca gaagcctccatccagtggca cctcctctga atttgaagtg gtcactcctg aggagcagaa ttcaccagagagcagcagcc atgccaatgc gatggcgctg ggccccctgc cccgtgagga cggcaacctgatgctgcacc tgcagcgcct ggagaccacg ctgagtgtgt gtgccgagga gccggaccacggccagctct tcacccacct gggccgcatg gccctggagt tcaaccgact ggcatccaaggtgcacaaga atgagcagcg cacctccatt ctgcagaccc tgtgtgagca gcttcggaaggagaacgagg ctctgaaggc caagttggat aagggcctgg aacagcggga tcaggctgccgagaggctgc gggaggaaaa tttggagctc aagaagttgt tgatgagcaa tggcaacaaagagggtgcgt ctgggcggcc aggctcaccg aagatggaag ggacaggcaa gaaggcagtggctggacagc agcaggctag tgtgacggca ggtaaggtcc cagaggtggt ggccttgggcgcagccgaga agaaggtgaa gatgctggag cagcagcgca gtgagctgct ggaagtgaacaagcagtggg accagcattt ccggtccatg aagcagcagt atgagcagaa gatcactgagctgcgtcaga agctggctga tttgcagaag caggtgactg acctggaggc cgagcgggagcagaagcagc gtgactttga ccgcaagctc ctcctggcca agtccaagat tgaaatggaggagaccgaca aggagcagct gacagcagag gccaaggagc tgcgccaaaa ggtcaagtacctgcaggatc agctgagccc actcacccga cagcgtgagt accaggaaaa ggagatccagcggctcaaca aggccctgga ggaagcactg agcatccaaa ccccgccatc atctccaccaacagcatttg ggagcccaga aggagcaggg gccctcctaa ggaaacagga gctggtcacgcagaatgagt tgctgaaaca gcaggtgaag atcttcgagg aggacttcca gagggagcgcagtgatcgtg agcgcatgaa tgaggagaag gaagagctga agaagcaagt ggagaagctgcaggcccagg tcaccctgtc aaatgcccag ctaaaagcat tcaaagatga ggagaaggcaagagaagccc tcagacagca gaagaggaaa gcaaaggcct caggagagcg ttaccatgtggagccccacc cagaacatct ctgcggggcc tacccctacg cctacccgcc catgccagccatggtgccac accatggctt cgaggactgg tcccagatcc gctacccccc tccccccatggccatggagc acccgccccc actccccaac tcgcgcctct tccatctgcc ggaatacacctggcgtctac cctgtggagg ggttcgaaat ccaaatcaga gctcccaagt gatggaccctcccacagcca ggcctacaga accagagtct ccaaaaaatg accgtgaggg gcctcagtga |
Target Names | TNIP1 |
Accession NO. | NM_001252390.1 |
HGNC | 16903 |
RGD | 1309380 |
MGI | 1926194 |
Still Have Questions? | Leave a Message or Start an on-line Chat |
Function | Inhibits NF-kappa-B activation and TNF-induced NF-kappa-B-dependent gene expression by regulating A20/TNFAIP3-mediated deubiquitination of IKBKG; proposed to link A20/TNFAIP3 to ubiquitinated IKBKG. Involved in regulation of EGF-induced ERK1/ERK2 signaling pathway; blocks MAPK3/MAPK1 nuclear translocation and MAPK1-dependent transcription. Increases cell surface CD4(T4) antigen expression. Involved in the anti-inflammatory response of macrophages and positively regulates TLR-induced activation of CEBPB. Involved in the prevention of autoimmunity; this function implicates binding to polyubiquitin. Involved in leukocyte integrin activation during inflammation; this function is mediated by association with SELPLG and dependent on phosphorylation by SRC-family kinases. Interacts with HIV-1 matrix protein and is packaged into virions and overexpression can inhibit viral replication. May regulate matrix nuclear localization, both nuclear import of PIC (Preintegration complex) and export of GAG polyprotein and viral genomic RNA during virion production. In case of infection, promotes association of IKBKG with Shigella flexneri E3 ubiquitin-protein ligase ipah9.8 p which in turn promotes polyubiquitination of IKBKG leading to its proteasome-dependent degradation and thus is perturbing NF-kappa-B activation during bacterial infection. |
Subcellular Location | Cytoplasm. Nucleus. Note=Shuttles between the nucleus and cytoplasm in a CRM1-dependent manner. |
Tissue Specificity | Ubiquitous. Strongly expressed in peripheral blood lymphocytes, spleen and skeletal muscle, and is weakly expressed in the brain. In peripheral blood mononucleocytes, isoform 4 is mainly expressed and isoform 1 and isoform 7 are almost not expressed. Expr |
Database Links |
HGNC: 16903 OMIM: 607714 KEGG: hsa:10318 STRING: 9606.ENSP00000317891 UniGene: Hs.355141 |
TNIP1 Antibodies for Homo sapiens (Human)
Code | Product Name | Species Reactivity | Application |
---|---|---|---|
CSB-PA619959LA01HU | TNIP1 Antibody | Human, Rat | ELISA, WB, IHC, IF |
CSB-PA619959LB01HU | TNIP1 Antibody, HRP conjugated | Human | ELISA |
CSB-PA619959LC01HU | TNIP1 Antibody, FITC conjugated | Human | |
CSB-PA619959LD01HU | TNIP1 Antibody, Biotin conjugated | Human | ELISA |
CSB-PA969029 | TNIP1 Antibody | Human | ELISA,WB,IHC |
CSB-PA944797 | TNIP1 Antibody | Human,Mouse | ELISA,WB,IHC |
CSB-PA023999GA01HU | TNIP1 Antibody | Human,Mouse,Rat | ELISA,WB,IHC,IF |
TNIP1 Proteins for Homo sapiens (Human)
Code | Product Name | Source |
---|---|---|
CSB-EP619959HU | Recombinant Human TNFAIP3-interacting protein 1 (TNIP1) | E.coli |
CSB-EP619959HUb1 | Recombinant Human TNFAIP3-interacting protein 1 (TNIP1) | E.coli |
CSB-YP619959HU CSB-BP619959HU CSB-MP619959HU CSB-EP619959HU-B |
Recombinant Human TNFAIP3-interacting protein 1 (TNIP1) | Yeast Baculovirus Mammalian cell In Vivo Biotinylation in E.coli |