TNIP1

Code CSB-CL619959HU2
Size 10 μg plasmid + 200μl Glycerol
Uniprot No. Q15025
Relevance Homo sapiens TNFAIP3 interacting protein 1 (TNIP1), transcript variant 3, mRNA.
Alias ABIN-1; NAF1; nip40-1; VAN
Immunogen Species Homo sapiens (Human)
Vector pUC
Sequence at ggaagcgaccaggctccggc agaaggcaga ggagctagtg aaggacaacg agctgctccc accaccttctccctccttgg gctccttcga ccccctggct gagctcacag gaaaggactc aaatgtcacagcatctccca cagcccctgc atgccccagt gacaagccag caccagtcca gaagcctccatccagtggca cctcctctga atttgaagtg gtcactcctg aggagcagaa ttcaccagagagcagcagcc atgccaatgc gatggcgctg ggccccctgc cccgtgagga cggcaacctgatgctgcacc tgcagcgcct ggagaccacg ctgagtgtgt gtgccgagga gccggaccacggccagctct tcacccacct gggccgcatg gccctggagt tcaaccgact ggcatccaaggtgcacaaga atgagcagcg cacctccatt ctgcagaccc tgtgtgagca gcttcggaaggagaacgagg ctctgaaggc caagttggat aagggcctgg aacagcggga tcaggctgccgagaggctgc gggaggaaaa tttggagctc aagaagttgt tgatgagcaa tggcaacaaagagggtgcgt ctgggcggcc aggctcaccg aagatggaag ggacaggcaa gaaggcagtggctggacagc agcaggctag tgtgacggca ggtaaggtcc cagaggtggt ggccttgggcgcagccgaga agaaggtgaa gatgctggag cagcagcgca gtgagctgct ggaagtgaacaagcagtggg accagcattt ccggtccatg aagcagcagt atgagcagaa gatcactgagctgcgtcaga agctggctga tttgcagaag caggtgactg acctggaggc cgagcgggagcagaagcagc gtgactttga ccgcaagctc ctcctggcca agtccaagat tgaaatggaggagaccgaca aggagcagct gacagcagag gccaaggagc tgcgccaaaa ggtcaagtacctgcaggatc agctgagccc actcacccga cagcgtgagt accaggaaaa ggagatccagcggctcaaca aggccctgga ggaagcactg agcatccaaa ccccgccatc atctccaccaacagcatttg ggagcccaga aggagcaggg gccctcctaa ggaaacagga gctggtcacgcagaatgagt tgctgaaaca gcaggtgaag atcttcgagg aggacttcca gagggagcgcagtgatcgtg agcgcatgaa tgaggagaag gaagagctga agaagcaagt ggagaagctgcaggcccagg tcaccctgtc aaatgcccag ctaaaagcat tcaaagatga ggagaaggcaagagaagccc tcagacagca gaagaggaaa gcaaaggcct caggagagcg ttaccatgtggagccccacc cagaacatct ctgcggggcc tacccctacg cctacccgcc catgccagccatggtgccac accatggctt cgaggactgg tcccagatcc gctacccccc tccccccatggccatggagc acccgccccc actccccaac tcgcgcctct tccatctgcc ggaatacacctggcgtctac cctgtggagg ggttcgaaat ccaaatcaga gctcccaagt gatggaccctcccacagcca ggcctacaga accagagtct ccaaaaaatg accgtgaggg gcctcagtga
Target Names TNIP1
Accession NO. NM_001252390.1
HGNC 16903
RGD 1309380
MGI 1926194
Still Have Questions? Leave a Message or Start an on-line Chat
Function Inhibits NF-kappa-B activation and TNF-induced NF-kappa-B-dependent gene expression by regulating A20/TNFAIP3-mediated deubiquitination of IKBKG; proposed to link A20/TNFAIP3 to ubiquitinated IKBKG. Involved in regulation of EGF-induced ERK1/ERK2 signaling pathway; blocks MAPK3/MAPK1 nuclear translocation and MAPK1-dependent transcription. Increases cell surface CD4(T4) antigen expression. Involved in the anti-inflammatory response of macrophages and positively regulates TLR-induced activation of CEBPB. Involved in the prevention of autoimmunity; this function implicates binding to polyubiquitin. Involved in leukocyte integrin activation during inflammation; this function is mediated by association with SELPLG and dependent on phosphorylation by SRC-family kinases. Interacts with HIV-1 matrix protein and is packaged into virions and overexpression can inhibit viral replication. May regulate matrix nuclear localization, both nuclear import of PIC (Preintegration complex) and export of GAG polyprotein and viral genomic RNA during virion production. In case of infection, promotes association of IKBKG with Shigella flexneri E3 ubiquitin-protein ligase ipah9.8 p which in turn promotes polyubiquitination of IKBKG leading to its proteasome-dependent degradation and thus is perturbing NF-kappa-B activation during bacterial infection.
Subcellular Location Cytoplasm. Nucleus. Note=Shuttles between the nucleus and cytoplasm in a CRM1-dependent manner.
Tissue Specificity Ubiquitous. Strongly expressed in peripheral blood lymphocytes, spleen and skeletal muscle, and is weakly expressed in the brain. In peripheral blood mononucleocytes, isoform 4 is mainly expressed and isoform 1 and isoform 7 are almost not expressed. Expr
Database Links

HGNC: 16903

OMIM: 607714

KEGG: hsa:10318

STRING: 9606.ENSP00000317891

UniGene: Hs.355141

Related Products

TNIP1 Antibodies

TNIP1 Antibodies for Homo sapiens (Human)

TNIP1 Proteins

TNIP1 Proteins for Homo sapiens (Human)

TNIP1 cDNA

TNIP1 cDNA for Homo sapiens (Human)

icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 7 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2025 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1