Code CSB-CL026288HU
Size 10 μg plasmid + 200μl Glycerol
Vector pENTR223.1
Sequence atggtggaccgcgagcaactggtgcagaaagcccggctggccgagcaggcggagcgctacgacgacatggccgcggccatgaagaacgtgacagagctgaatgagccactgtcgaatgaggaacgaaaccttctgtctgtggcctacaagaacgttgtgggggcacgccgctcttcctggagggtcatcagtagcattgagcagaagacatctgcagacggcaatgagaagaagattgagatggtccgtgcgtaccgggagaagatagagaaggagttggaggctgtgtgccaggatgtgctgagcctgctggataactacctgatcaagaattgcagcgagacccagtacgagagcaaagtgttctacctgaagatgaaaggggactactaccgctacctggctgaagtggccaccggagagaaaagggcgacggtggtggagtcctctgagaaggcctacagcgaagcccacgagatcagcaaagagcacatgcagcccacccaccccatccgattaggcctggctcttaactactccgtcttctactatgagatccagaacgccccagagcaagcgtgccacttggccaagaccgcgttcgacgacgccatcgccgagcttgacaccctcaacgaggactcctacaaggactccacgctcatcatgcagctcctccgcgacaacctcacgctctggacgagcgaccagcaggacgacgatggcggcgaaggcaacaattaa
Accession NO. BC020963
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers

Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
7505 Fannin St. Ste 610-312, Houston, TX 77054, USA
Join Us with

Subscribe newsletter

Leave a message

© 2007-2022 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1