ADAMTS12

Code CSB-CL001300HU3
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 12, mRNA
Alias PRO4389
Vector pUC
Sequence ATGCCATGTGCCCAGAGGAGCTGGCTTGCAAACCTTTCCGTGGTGGCTCAGCTCCTTAACTTTGGGGCGCTTTGCTATGGGAGACAGCCTCAGCCAGGCCCGGTTCGCTTCCCGGACAGGAGGCAAGAGCATTTTATCAAGGGCCTGCCAGAATACCACGTGGTGGGTCCAGTCCGAGTAGATGCCAGTGGGCATTTTTTGTCATATGGCTTGCACTATCCCATCACGAGCAGCAGGAGGAAGAGAGATTTGGATGGCTCAGAGGACTGGGTGTACTACAGAATTTCTCACGAGGAGAAGGACCTGTTTTTTAACTTGACGGTCAATCAAGGATTTCTTTCCAATAGCTACATCATGGAGAAGAGATATGGGAACCTCTCCCATGTTAAGATGATGGCTTCCTCTGCCCCCCTCTGCCATCTCAGTGGCACGGTTCTACAGCAGGGCACCAGAGTTGGGACGGCAGCCCTCAGTGCCTGCCATGGACTGACTGGATTTTTCCAACTACCACATGGAGACTTTTTCATTGAACCCGTGAAGAAGCATCCACTGGTTGAGGGAGGGTACCACCCGCACATCGTTTACAGGAGGCAGAAAGTTCCAGAAACCAAGGAGCCAACCTGTGGATTAAAGGGTATTGTGACTCACATGTCCTCCTGGGTTGAAGAATCTGTTTTGTTCTTTTGGTAG
Accession NO. BC139900
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

Copyright © 2007-2018 www.cusabio.com CUSABIO TECHNOLOGY LLC All Rights Reserved.