ANXA2

Code CSB-CL001840HU2
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens annexin A2, mRNA (cDNA clone MGC:24294 IMAGE:3961419), complete cds
Alias LIP2;LPC2;P36;PAP-IV
Vector pENTR223.1
Sequence atgtctactgttcacgaaatcctgtgcaagctcagcttggagggtgatcactctacacccccaagtgcatatgggtctgtcaaagcctatactaactttgatgctgagcgggatgctttgaacattgaaacagccatcaagaccaaaggtgtggatgaggtcaccattgtcaacattttgaccaaccgcagcaatgcacagagacaggatattgccttcgcctaccagagaaggaccaaaaaggaacttgcatcagcactgaagtcagccttatctggccacctggagacggtgattttgggcctattgaagacacctgctcagtatgacgcttctgagctaaaagcttccatgaaggggctgggaaccgacgaggactctctcattgagatcatctgctccagaaccaaccaggagctgcaggaaattaacagagtctacaaggaaatgtacaagactgatctggagaaggacattatttcggacacatctggtgacttccgcaagctgatggttgccctggcaaagggtagaagagcagaggatggctctgtcattgattatgaactgattgaccaagatgctcgggatctctatgacgctggagtgaagaggaaaggaactgatgttcccaagtggatcagcatcatgaccgagcggagcgtgccccacctccagaaagtatttgataggtacaagagttacagcccttatgacatgttggaaagcatcaggaaagaggttaaaggagacctggaaaatgctttcctgaacctggttcagtgcattcagaacaagcccctgtattttgctgatcggctgtatgactccatgaagggcaaggggacgcgagataaggtcctgatcagaatcatggcctcccgcagtgaagtggacatgttgaaaattaggtctgaattcaagagaaagtacggcaagtccctgtactattatatccagcaagacactaagggcgactaccagaaagcgctgctgtacctgtgtggtggagatgactga
Accession NO. BC023990
Still Have Questions? Leave a Message or Start an on-line Chat
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
Address
7505 Fannin St., Ste 610, Room 322 (CUBIO Innovation Center), Houston, TX 77054, USA
Join Us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2023 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1