Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
| Code | CSB-CL001991HU |
| Size | 10 μg plasmid + 200μl Glycerol |
| Relevance | Homo sapiens ADP-ribosylation factor 4, mRNA (cDNA clone MGC:5322 IMAGE:2900495), complete cds |
| Vector | pENTR223.1 |
| Sequence | atgggcctcactatctcctccctcttctcccgactatttggcaagaagcagatgcgcattttgatggttggattggatgctgctggcaagacaaccattctgtataaactgaagttaggggagatagtcaccaccattcctaccattggttttaatgtggaaacagtagaatataagaacatttgtttcacagtatgggatgttggtggtcaagatagaattaggcctctctggaagcattacttccagaatacccagggtcttatttttgtggtagatagcaacgatcgtgaaagaattcaggaagtagcagatgagctgcagaaaatgcttctggtagatgaattgagagatgcagtgctgctactttttgcaaacaaacaggatttgccaaatgctatggccatcagtgaaatgacagataaactagggcttcagtctcttcgtaacagaacatggtatgttcaagccacttgtgcaacacaaggaactggtctgtatgaaggacttgactggctgtcaaatgagctttcaaaacgttaa |
| Accession NO. | BC003364 |
| Still Have Questions? | Leave a Message or Start an on-line Chat |
Recombinant Human Interleukin-1 alpha protein(IL1A) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-1 beta protein(IL1B) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-1 receptor antagonist protein(IL1RN) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-4 protein(IL4) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-5 protein(IL5) (Active)
Express system: E.Coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-6 protein(IL6) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-9 protein(IL9) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-10 protein(IL10) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
