C17orf89

Code CSB-CL003393HU
Size 10 μg plasmid + 200μl Glycerol
Relevance Homo sapiens chromosome 17 open reading frame 89, mRNA (cDNA clone MGC:157966 IMAGE:40134528), complete cds
Vector pUC
Sequence ATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAAGCCGCCTCCGCGCCTTCCCCGAGCGGCTGGCCGCCTGCGGGGCCGAGGCCGCGGCGTACGGCAGGTGCGTGCAGGCCTCCACGGCCCCGGGCGGCCGCCTGAGTAAGGACTTCTGCGCGCGGGAGTTCGAGGCCCTGCGGAGCTGCTTCGCCGCTGCGGCCAAGAAGACGCTGGAGGGAGGCTGTTAG
Accession NO. BC127837
Still Have Questions? Leave a Message or Start an on-line Chat

Most popular with customers

Newsletters

Get all the latest information on Events, Sales and Offers. Sign up for newsletter today.

© 2007-2022 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1