Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
| Code | CSB-CL005938HU1 |
| Size | 10 μg plasmid + 200μl Glycerol |
| Relevance | Homo sapiens CASP2 and RIPK1 domain containing adaptor with death domain, mRNA (cDNA clone MGC:9163 IMAGE:3849848), complete cds |
| Alias | MGC9163;RAIDD |
| Vector | pENTR223.1 |
| Sequence | atggaggccagagacaaacaagtactccgctcacttcgcctggagctgggtgcagaggtattggtggagggactggttcttcagtacctctaccaggaaggaatcttgacggaaaaccatattcaagaaatcaatgctcaaaccacaggcctccggaaaacaatgctcctgctggatatcctaccttccaggggccctaaagcatttgatacattcctagattccctacaggagtttccctgggtcagggagaagctgaagaaggcaagggaagaggccatgaccgacctgcctgcaggtgacagattgactgggatcccctcgcacatcctcaacagctccccatcagaccggcagattaaccagctggcccagaggctgggccctgagtgggagcccatggtgctgtctctgggactgtcccagacggatatctaccgctgtaaggccaaccacccccacaacgtgcagtcgcaggtggtggaggccttcatccgttggcggcagcgcttcgggaagcaggccaccttccagagcctgcacaacgggctgcgggctgtggaggtggacccctcgctgctcctgcacatgttggagtga |
| Accession NO. | BC017042 |
| Still Have Questions? | Leave a Message or Start an on-line Chat |
Recombinant Human interleukin-16 protein(IL16) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human interleukin-16 proein(IL16) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-1 beta protein(IL1B) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-2 protein(IL2) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-4 protein(IL4) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-6 protein(IL6) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-9 protein(IL9) (Active)
Express system: E.coli
Species: Homo sapiens (Human)
Recombinant Human Interleukin-33 protein(IL33),partial (Active)
Express system: E.coli
Species: Homo sapiens (Human)
