ACE2

Code CSB-CL866317HU1
Product Type Clone
Size 10 μg plasmid + 200 μl Glycerol
Uniprot No. Q9BYF1
Relevance Homo sapiens angiotensin I converting enzyme 2 (ACE2), mRNA.
Alias ACEH
Vector pUC
Sequence atgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttag
Gene ID 59272
Accession NO. NM_021804.2
Still Have Questions? Leave a Message or Start an on-line Chat
Function Essential counter-regulatory carboxypeptidase of the renin-angiotensin hormone system that is a critical regulator of blood volume, systemic vascular resistance, and thus cardiovascular homeostasis. Converts angiotensin I to angiotensin 1-9, a nine-amino acid peptide with anti-hypertrophic effects in cardiomyocytes, and angiotensin II to angiotensin 1-7, which then acts as a beneficial vasodilator and anti-proliferation agent, counterbalancing the actions of the vasoconstrictor angiotensin II. Also removes the C-terminal residue from three other vasoactive peptides, neurotensin, kinetensin, and des-Arg bradykinin, but is not active on bradykinin. Also cleaves other biological peptides, such as apelins (apelin-13, Non-functional as a carboxypeptidase.; (Microbial infection) Acts as a receptor for human coronaviruses SARS-CoV and SARS-CoV-2, as well as human coronavirus NL63/HCoV-NL63.; (Microbial infection) Non-functional as a receptor for human coronavirus SARS-CoV-2.
Subcellular Location [Processed angiotensin-converting enzyme 2]: Secreted.; Cell membrane; Single-pass type I membrane protein. Cytoplasm. Cell projection, cilium. Apical cell membrane.; [Isoform 2]: Apical cell membrane.
Protein Families Peptidase M2 family
Tissue Specificity Expressed in endothelial cells from small and large arteries, and in arterial smooth muscle cells (at protein level). Expressed in enterocytes of the small intestine, Leydig cells and Sertoli cells (at protein level). Expressed in the renal proximal tubul
Database Links

HGNC: 13557

OMIM: 300335

KEGG: hsa:59272

STRING: 9606.ENSP00000252519

UniGene: Hs.178098

Pathway Renin-angiotensin system
Virus Infection

Related Products

Antibodies

Antibodies for Homo sapiens (Human)

Proteins

Proteins for Homo sapiens (Human)

ELISA Kit

ELISA Kit for Homo sapiens (Human)

icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
7505 Fannin St., Ste 610, Room 322 (CUBIO Innovation Center), Houston, TX 77054, USA
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2024 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1