Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
| Code | CSB-CL866317HU1 |
| Product Type | Clone |
| Size | 10 μg plasmid + 200 μl Glycerol |
| Uniprot No. | Q9BYF1 |
| Relevance | Homo sapiens angiotensin I converting enzyme 2 (ACE2), mRNA. |
| Alias | ACEH |
| Vector | pUC |
| Sequence | atgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttag |
| Gene ID | 59272 |
| Accession NO. | NM_021804.2 |
| Still Have Questions? | Leave a Message or Start an on-line Chat |
| Function | Essential counter-regulatory carboxypeptidase of the renin-angiotensin hormone system that is a critical regulator of blood volume, systemic vascular resistance, and thus cardiovascular homeostasis. Converts angiotensin I to angiotensin 1-9, a nine-amino acid peptide with anti-hypertrophic effects in cardiomyocytes, and angiotensin II to angiotensin 1-7, which then acts as a beneficial vasodilator and anti-proliferation agent, counterbalancing the actions of the vasoconstrictor angiotensin II. Also removes the C-terminal residue from three other vasoactive peptides, neurotensin, kinetensin, and des-Arg bradykinin, but is not active on bradykinin. Also cleaves other biological peptides, such as apelins (apelin-13, Non-functional as a carboxypeptidase.; (Microbial infection) Acts as a receptor for human coronaviruses SARS-CoV and SARS-CoV-2, as well as human coronavirus NL63/HCoV-NL63.; (Microbial infection) Non-functional as a receptor for human coronavirus SARS-CoV-2. |
| Subcellular Location | [Processed angiotensin-converting enzyme 2]: Secreted.; Cell membrane; Single-pass type I membrane protein. Cytoplasm. Cell projection, cilium. Apical cell membrane.; [Isoform 2]: Apical cell membrane. |
| Protein Families | Peptidase M2 family |
| Tissue Specificity | Expressed in endothelial cells from small and large arteries, and in arterial smooth muscle cells (at protein level). Expressed in enterocytes of the small intestine, Leydig cells and Sertoli cells (at protein level). Expressed in the renal proximal tubul |
| Database Links |
HGNC: 13557 OMIM: 300335 KEGG: hsa:59272 STRING: 9606.ENSP00000252519 UniGene: Hs.178098 |
| Pathway |
Renin-angiotensin system
Virus Infection Target Therapy |
Antibodies for Homo sapiens (Human)
| Code | Product Name | Species Reactivity | Application |
|---|---|---|---|
| CSB-RA866317MA1HU | ACE2 Recombinant Monoclonal Antibody | Human | ELISA, IHC |
| CSB-PA866317LA01HU | ACE2 Antibody | Human | ELISA, IHC, IF |
| CSB-PA866317LB01HU | ACE2 Antibody, HRP conjugated | Human | ELISA |
| CSB-PA866317LC01HU | ACE2 Antibody, FITC conjugated | Human | |
| CSB-PA866317LD01HU | ACE2 Antibody, Biotin conjugated | Human | ELISA |
| CSB-PA111496 | ACE2 Antibody | Human | ELISA,IHC |
| CSB-PA025395 | ACE2 Antibody | Human,Mouse,Rat | ELISA,IHC |
| CSB-PA445794 | ACE2 Antibody | Human,Mouse,Rat | ELISA,IHC |
| CSB-PA001150GA01HU | ACE2 Antibody | Human,Mouse,Rat | ELISA,WB |
| CSB-PA040178 | ACE2 Antibody | Human,Mouse | WB, ELISA |
Proteins for Homo sapiens (Human)
| Code | Product Name | Source |
|---|---|---|
| CSB-MP866317HU | Recombinant Human Angiotensin-converting enzyme 2 (ACE2), partial (Active) | Mammalian cell |
| CSB-MP866317HU-B | Recombinant Human Angiotensin-converting enzyme 2 (ACE2), partial,Biotinylated (Active) | Mammalian cell |
| CSB-MP866317HUb0 | Recombinant Human Angiotensin-converting enzyme 2 (ACE2), partial | Mammalian cell |
| CSB-AP005671HU | Recombinant Human Angiotensin-converting enzyme 2 (ACE2), partial (Active) | Mammalian cell |
| CSB-YP866317HU CSB-EP866317HU CSB-BP866317HU CSB-EP866317HU-B |
Recombinant Human Angiotensin-converting enzyme 2 (ACE2), partial | Yeast E.coli Baculovirus In Vivo Biotinylation in E.coli |
ELISA Kit for Homo sapiens (Human)
| Code | Product Name | Sample Types | Sensitivity |
|---|---|---|---|
| CSB-E04489h | Human Angiotensin converting enzyme 2, ACE2 ELISA Kit | serum, plasma, cell culture supernates | 0.039 ng/mL |